ID: 1024156766

View in Genome Browser
Species Human (GRCh38)
Location 7:46633986-46634008
Sequence AGGCAATGAGCAGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024156766_1024156773 19 Left 1024156766 7:46633986-46634008 CCTTCCTCCACTGCTCATTGCCT No data
Right 1024156773 7:46634028-46634050 GAGTAAACTATGCATGCATTAGG No data
1024156766_1024156770 -3 Left 1024156766 7:46633986-46634008 CCTTCCTCCACTGCTCATTGCCT No data
Right 1024156770 7:46634006-46634028 CCTCTCCAACCACTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024156766 Original CRISPR AGGCAATGAGCAGTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr