ID: 1024156766 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:46633986-46634008 |
| Sequence | AGGCAATGAGCAGTGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024156766_1024156773 | 19 | Left | 1024156766 | 7:46633986-46634008 | CCTTCCTCCACTGCTCATTGCCT | No data | ||
| Right | 1024156773 | 7:46634028-46634050 | GAGTAAACTATGCATGCATTAGG | No data | ||||
| 1024156766_1024156770 | -3 | Left | 1024156766 | 7:46633986-46634008 | CCTTCCTCCACTGCTCATTGCCT | No data | ||
| Right | 1024156770 | 7:46634006-46634028 | CCTCTCCAACCACTGAGCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024156766 | Original CRISPR | AGGCAATGAGCAGTGGAGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||