ID: 1024159520

View in Genome Browser
Species Human (GRCh38)
Location 7:46660009-46660031
Sequence ATGTATACACATATGATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024159520_1024159530 28 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159530 7:46660060-46660082 AATTGGGCCATGTGATTATGGGG No data
1024159520_1024159527 12 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159527 7:46660044-46660066 AGAGAGGTAATATGGGAATTGGG No data
1024159520_1024159526 11 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159526 7:46660043-46660065 GAGAGAGGTAATATGGGAATTGG No data
1024159520_1024159524 4 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159524 7:46660036-46660058 GGAGCGAGAGAGAGGTAATATGG No data
1024159520_1024159529 27 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159529 7:46660059-46660081 GAATTGGGCCATGTGATTATGGG No data
1024159520_1024159525 5 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159525 7:46660037-46660059 GAGCGAGAGAGAGGTAATATGGG No data
1024159520_1024159523 -4 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159523 7:46660028-46660050 ACATACATGGAGCGAGAGAGAGG No data
1024159520_1024159528 26 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159528 7:46660058-46660080 GGAATTGGGCCATGTGATTATGG No data
1024159520_1024159531 29 Left 1024159520 7:46660009-46660031 CCCTGTATCATATGTGTATACAT No data
Right 1024159531 7:46660061-46660083 ATTGGGCCATGTGATTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024159520 Original CRISPR ATGTATACACATATGATACA GGG (reversed) Intergenic
No off target data available for this crispr