ID: 1024161467

View in Genome Browser
Species Human (GRCh38)
Location 7:46680659-46680681
Sequence GAATCACTTAGAAGGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024161463_1024161467 -6 Left 1024161463 7:46680642-46680664 CCGCACACCAATAATTAGAATCA 0: 1
1: 0
2: 0
3: 22
4: 203
Right 1024161467 7:46680659-46680681 GAATCACTTAGAAGGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024161467 Original CRISPR GAATCACTTAGAAGGAGGCC TGG Intronic
No off target data available for this crispr