ID: 1024163801

View in Genome Browser
Species Human (GRCh38)
Location 7:46709260-46709282
Sequence CCCTTTCAGCAGAAGACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024163801_1024163806 -6 Left 1024163801 7:46709260-46709282 CCACCTGTCTTCTGCTGAAAGGG 0: 1
1: 1
2: 4
3: 19
4: 225
Right 1024163806 7:46709277-46709299 AAAGGGATGTTCAGGTGGTTTGG No data
1024163801_1024163807 15 Left 1024163801 7:46709260-46709282 CCACCTGTCTTCTGCTGAAAGGG 0: 1
1: 1
2: 4
3: 19
4: 225
Right 1024163807 7:46709298-46709320 GGCATTTGATTAGAATGATTAGG 0: 3
1: 13
2: 17
3: 30
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024163801 Original CRISPR CCCTTTCAGCAGAAGACAGG TGG (reversed) Intronic
900917374 1:5648243-5648265 CCCTTTCATCAGAGGCCTGGAGG - Intergenic
901088528 1:6626373-6626395 CCCTTTGGGCAGGAGAGAGGAGG - Intronic
904323833 1:29714275-29714297 CCCTTAGAGCACAAGACAGATGG - Intergenic
904629465 1:31830180-31830202 GCCCTTCAGCAGAAGGCAGTGGG + Intergenic
905239539 1:36572806-36572828 CCCTGTCCCCTGAAGACAGGAGG + Intergenic
905690846 1:39941497-39941519 CCTTTTCTCCAGAAGTCAGGTGG + Intergenic
906318486 1:44802871-44802893 CAGGTTCAGCAGCAGACAGGTGG + Intronic
906344089 1:45004452-45004474 GCCTTTTAGCAGCAGAAAGGTGG + Intronic
907144817 1:52222367-52222389 GCCCTTCAGCAGAAGATAGTCGG - Intronic
907278336 1:53328895-53328917 TCCTTCCTGCAGAAGACAGCAGG - Intergenic
907486126 1:54779469-54779491 CCATTGCAGCAGAGGCCAGGAGG - Intergenic
908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG + Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909579980 1:77222652-77222674 CCCTCTCATCACAAGCCAGGAGG - Intergenic
910510098 1:87993840-87993862 CCCTTTGTGCAGTAGACAGAGGG - Intergenic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
917041398 1:170809810-170809832 TCCTTTCAGCAGAAGACCCTGGG - Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
920224641 1:204429760-204429782 TCCAGTCTGCAGAAGACAGGAGG - Intronic
920565471 1:206969422-206969444 TCCTTTCTCCAGGAGACAGGGGG + Intronic
922415156 1:225414814-225414836 TTCTCTCAGCAGAAGACAGATGG + Intronic
922829709 1:228545811-228545833 CCCTATCATTAGAAGACTGGGGG + Intergenic
922916625 1:229263345-229263367 CCCTGTGAGCAGAACACATGTGG + Intergenic
923025697 1:230202239-230202261 CTCAAACAGCAGAAGACAGGTGG - Intronic
923659586 1:235946627-235946649 CCCTTTCAGAAGGACACAGTGGG - Intergenic
1064980306 10:21159979-21160001 CCCTAGCAGGAGAAAACAGGTGG - Intronic
1065021906 10:21508655-21508677 CCCTTTAAACAAAAGACAAGAGG + Intergenic
1066312789 10:34213737-34213759 GCCTGGCAGCAGAGGACAGGAGG + Intronic
1069020151 10:63477658-63477680 AACTTTCAGAAGAAAACAGGAGG + Intergenic
1070092904 10:73306247-73306269 CCCTTTCTAGAGAAGAAAGGGGG + Intronic
1070154241 10:73823986-73824008 CCAGGTCAGCAGGAGACAGGTGG - Intronic
1070458442 10:76641546-76641568 CCCATCAAACAGAAGACAGGAGG - Intergenic
1070659752 10:78296072-78296094 CCCTTTGCACAGAAGCCAGGGGG + Intergenic
1071520578 10:86329498-86329520 TCCTTTCACCAGTAGGCAGGGGG - Intronic
1071824103 10:89307394-89307416 CCCTTTCAGCAGTAGCCTAGTGG - Exonic
1073010101 10:100352345-100352367 CCCTGCCAGGAGAAGACAGTGGG - Exonic
1073603813 10:104873081-104873103 CCCTTTCTGCAGCAGAGAGCTGG + Intronic
1073733037 10:106313304-106313326 GCTTTTCATCAGAAGACATGAGG + Intergenic
1075331353 10:121576477-121576499 CCCTTTCATCAAAAGGCATGTGG + Intronic
1075604355 10:123793542-123793564 CCCTTTCAGGAGAAGCCTGGTGG - Intronic
1076370521 10:129949951-129949973 CCCTCTCAGCAGAAAGCAGTTGG - Intronic
1077212851 11:1381396-1381418 CACATTTAGCAGAAGACAGCTGG + Intergenic
1077922232 11:6650303-6650325 CCCTTTCACCAGGAGACACAGGG + Intronic
1078520452 11:12058704-12058726 CCCTTCCTGCTGAAGCCAGGTGG - Intergenic
1079528557 11:21420677-21420699 CCCTGTCATCAGAAGACTGGAGG + Intronic
1079777931 11:24557879-24557901 TCCTTTCAGCAGAAGAGAAACGG - Intronic
1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG + Intergenic
1083752923 11:64771523-64771545 CCCTTTAGGCTGAAGACAGTGGG - Intronic
1084389182 11:68864030-68864052 CCCTTCCTGCAGAATTCAGGAGG + Intergenic
1084604912 11:70166761-70166783 CCCTTTCCCCAAAAGGCAGGGGG - Intronic
1086616033 11:88821263-88821285 CCCTTTTAATAGAAAACAGGAGG - Intronic
1086807843 11:91267547-91267569 CCCTTTCAGCAGAAAAGGGTTGG + Intergenic
1087510044 11:99080517-99080539 TCCTATCAGCAGAAGAGAAGGGG + Intronic
1090407807 11:126487884-126487906 CCCTTTCAGGACAGGACAGAAGG - Intronic
1090929578 11:131283543-131283565 CCTTTCCAGCACAACACAGGCGG - Intergenic
1091630557 12:2157345-2157367 CCATTTCAGCTGAGGACTGGAGG + Intronic
1091706132 12:2694699-2694721 CCCATGCAGCTGAAGACAGTGGG + Intronic
1095732493 12:45521187-45521209 CCCTTTCAGCAGAAGAGGGGTGG + Intergenic
1097788240 12:63784652-63784674 TCATTTCAGAATAAGACAGGTGG + Intronic
1098013633 12:66081169-66081191 CCACCCCAGCAGAAGACAGGAGG + Intergenic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1099370989 12:81829644-81829666 GCCTTAGAGCAGAAGAAAGGAGG - Intergenic
1099941344 12:89192886-89192908 AACTTTATGCAGAAGACAGGAGG + Intergenic
1101158558 12:101951181-101951203 CACTTGGAGCAGAAGACAGAGGG - Intronic
1103019878 12:117525434-117525456 CCCATTTAGCACAAGAGAGGTGG - Intronic
1103129819 12:118458391-118458413 CCCTTTCAGCAGGTGACCTGGGG - Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1105024983 12:132842193-132842215 CCCTGTCAGCAGATGCCACGGGG - Intronic
1105651065 13:22378649-22378671 CCCTTTCAGAAGAAATTAGGAGG - Intergenic
1105753506 13:23444019-23444041 CCCTTTCAGCAGAAGAGGGATGG - Intergenic
1105829757 13:24153554-24153576 CACTTTCAACAGAGGACACGTGG + Intronic
1106653726 13:31719698-31719720 CCCTTTCAGAAGAAGACAGGCGG + Intergenic
1108841917 13:54628213-54628235 CCCTTTCAACAGAAGTGAGATGG + Intergenic
1109794325 13:67289737-67289759 CCATGCCAGCAGAAGACAGGAGG - Intergenic
1112311016 13:98317628-98317650 CACTTACAGCAAAAGACAGAGGG - Intronic
1113698703 13:112366794-112366816 CCCCTCCAGCAGAAGTCAAGTGG + Intergenic
1116778781 14:49212762-49212784 CCCTTTCAGCGGAAGAGGGATGG - Intergenic
1118618665 14:67594685-67594707 CTCCCTCAGCAGAATACAGGAGG + Intronic
1120249928 14:82050974-82050996 CCCTTTAAGCAGAAGACAAAGGG - Intergenic
1121263648 14:92584529-92584551 CCCTTTGTGCAGCAGAGAGGAGG - Intronic
1121382974 14:93490237-93490259 CCATCTCAACAGAAGCCAGGAGG - Intronic
1122291466 14:100682511-100682533 CCCTTTCATCAGGATTCAGGGGG - Intergenic
1129126154 15:73443075-73443097 CCCGTTCAGCAGAAGCCAATGGG - Intergenic
1129452776 15:75659994-75660016 CCCTTTCAGCAGGAGATTGGGGG + Exonic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1133379320 16:5316740-5316762 CCCTTTCAGCAGAAGAGAGATGG - Intergenic
1133392907 16:5423503-5423525 CCCCTTCACCATGAGACAGGTGG - Intergenic
1135622399 16:23967309-23967331 CCCTGACAGCAGAAGACAAAAGG + Intronic
1135739202 16:24958826-24958848 CCCTTTCAGCTCAAGACCAGTGG + Intronic
1136565789 16:31069363-31069385 CTCTTTGAGGAGAAGAAAGGAGG - Intronic
1136655549 16:31707031-31707053 ACCTTCCAGCAGGAGCCAGGTGG - Intergenic
1137400062 16:48146114-48146136 CCTTTTCACCAAAGGACAGGAGG + Intronic
1138079165 16:54072462-54072484 CCCCTTCAGCAGGAGACAACTGG - Intronic
1138149479 16:54642941-54642963 CCCTCTCTGCTGGAGACAGGAGG - Intergenic
1138925329 16:61583363-61583385 CCCTATCAGTAAAAGACAAGAGG - Intergenic
1138969855 16:62131343-62131365 CCCTATCAGCAGTATATAGGGGG - Intergenic
1140253719 16:73317257-73317279 CCCTTTAAACAGAAGCCGGGGGG + Intergenic
1143493091 17:7294916-7294938 CCCTTCCCGCAGAGGCCAGGTGG - Intergenic
1144675496 17:17158933-17158955 CCCCATCTTCAGAAGACAGGTGG - Exonic
1144824949 17:18100560-18100582 CTCTTTCAGCCCAAGAAAGGTGG + Exonic
1146704451 17:34990705-34990727 TACTTGCAGGAGAAGACAGGAGG - Intronic
1148811343 17:50293836-50293858 CACTTTCAGCAACAGACAGATGG + Intergenic
1148978181 17:51547776-51547798 ACCGTTCAGCAGAACACAGAGGG + Intergenic
1150021721 17:61621841-61621863 CCCCTTCAGCAGAAGAGAGATGG + Intergenic
1150133624 17:62682223-62682245 CCCTTTCCGCAGAGGACTGGGGG + Exonic
1151032167 17:70754142-70754164 CCATTTCATCAAAAGAAAGGGGG + Intergenic
1152241885 17:79165231-79165253 CCCTTTCAGAAGATGACACAAGG - Intronic
1152800147 17:82327109-82327131 CCCTTTCCCCAGCAGAGAGGCGG + Intronic
1153895840 18:9558883-9558905 CCCTTTCAACAGAACACACAAGG - Intronic
1155304733 18:24467851-24467873 ACTTTTTAGTAGAAGACAGGTGG + Intronic
1157546127 18:48547687-48547709 CCCTTCCAGCAGAAGCAAGCAGG - Intronic
1159895998 18:73996612-73996634 CCCCTGCAGCAGAGGACAGGTGG - Intergenic
1164575649 19:29403975-29403997 CCCTTTCAGCTGGTGGCAGGAGG + Intergenic
1164742223 19:30584215-30584237 CACTTGCAGCAGGATACAGGAGG - Intronic
1164790397 19:30972577-30972599 CCCCCTCTGCAGATGACAGGAGG + Intergenic
1164964745 19:32472561-32472583 CTCTTTCAGCAAAAGTCAGGCGG + Intronic
1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG + Intronic
1168609757 19:57789799-57789821 CCTTATCAGTAGAAGAAAGGGGG + Intronic
926624381 2:15078591-15078613 CCTTTTCCCCAGAAGACAGTGGG - Intergenic
927192456 2:20525946-20525968 CCATTTCATAAGAAGGCAGGAGG + Intergenic
931145750 2:59515471-59515493 CACTTATAGCAGAAGACAGCTGG - Intergenic
933764236 2:85696079-85696101 TCCATTGAGCAGCAGACAGGAGG - Intronic
935316272 2:101837397-101837419 TCCTGCCAGCAGAAGACAGAGGG - Intronic
937663988 2:124463487-124463509 CCCTGTCAGCAGAAAATACGAGG + Intronic
940460595 2:153958927-153958949 CACTTACAGCAGTAGACAAGTGG - Intronic
941165536 2:162079167-162079189 CCCTTCCATCACAAGCCAGGAGG - Intergenic
943084123 2:183292019-183292041 CCTTTGCAGCACAACACAGGAGG - Intergenic
943998033 2:194796897-194796919 CCCTTCCATCACAAGCCAGGAGG + Intergenic
944479442 2:200141334-200141356 CACTTTTAGAAGAAAACAGGAGG + Intergenic
945967254 2:216201712-216201734 CCCTTTCTGCAGAAGAGATTCGG + Intronic
948540406 2:238687316-238687338 CCTTTTCATCAGCAGACACGAGG - Intergenic
1171003023 20:21433878-21433900 CCCTTCAAGCAGAAGCCAGCTGG + Intergenic
1174728654 20:52891916-52891938 CCCCTTCTGCAGCAGCCAGGTGG + Intergenic
1175428308 20:58884920-58884942 ACCCATCAGCAGAACACAGGCGG - Intronic
1178158161 21:29879159-29879181 AACTTTCAGTAGAAGACAGAGGG + Intronic
1181063061 22:20291171-20291193 CCCTTTCAGAAGTGAACAGGAGG - Intergenic
1182755607 22:32676402-32676424 CCCTATCTGCAGAAGCCCGGAGG + Intronic
1183075907 22:35426601-35426623 CCCTTTCTACAGATGAAAGGAGG - Intergenic
1183245644 22:36691291-36691313 GCCTTTGGGCAGAAGGCAGGGGG + Intronic
1183387209 22:37521705-37521727 CCCTGTCTGCAAAAGGCAGGCGG + Intergenic
1184839192 22:47042694-47042716 CCCTCTCAGCAGTGGACAGATGG - Intronic
1185173158 22:49305098-49305120 CCCTGTTTGCAGAAGACAGCAGG + Intergenic
949805719 3:7953267-7953289 CCCTTTCAGCAGAAAAGGGAAGG + Intergenic
953626854 3:44579036-44579058 CCCCATCTTCAGAAGACAGGTGG + Intronic
954513691 3:51151824-51151846 CTCTATAAGCAGAAGACAGTGGG - Intronic
955236394 3:57143523-57143545 CCCTATCAGAAGTAGGCAGGAGG + Intronic
955980283 3:64518422-64518444 TCCTTGCAGCTGAAGACATGGGG + Intronic
956385663 3:68715890-68715912 TCCTCTCAGCAGAAAATAGGAGG - Intergenic
959829353 3:110841961-110841983 CCATTTAAGCAGAAGTCAGATGG + Intergenic
962069692 3:132020462-132020484 CCCTTTCCTGAGAAGACAGCCGG - Intronic
962563414 3:136632521-136632543 TCCTTTCAGCAGATGCCAGCTGG - Intronic
963810812 3:149774541-149774563 CTCATTCAGCAGTAGGCAGGAGG - Intronic
964824334 3:160808847-160808869 CCCTTTCTGAAGAGGAGAGGAGG + Intronic
964891571 3:161542358-161542380 TCTCTTCAGCTGAAGACAGGAGG + Intergenic
968964085 4:3760711-3760733 CCCTAGCAGGAGAAGCCAGGTGG + Intergenic
969592421 4:8129685-8129707 ACCTTTCAGCAGCAGCCAGTGGG + Intronic
971498173 4:27289799-27289821 CCATTTCATCAGAAAACAGGAGG + Intergenic
972840817 4:42928325-42928347 CCCATCCAGCAGATGACATGAGG + Intronic
973530583 4:51833618-51833640 CCTTCTCAGCCAAAGACAGGAGG + Intergenic
975374412 4:73626986-73627008 CACTTTTAGAAGAAAACAGGGGG - Intergenic
976315686 4:83656499-83656521 CCACTTCAGCAGAGGACAGCTGG - Intergenic
976806470 4:89052636-89052658 CCATGTCAACAGAAGCCAGGAGG - Intronic
977028136 4:91847171-91847193 GCATTTGAGCAGAAGACTGGTGG + Intergenic
977232013 4:94462850-94462872 CCCTGTAAAAAGAAGACAGGTGG - Intronic
982703787 4:158685795-158685817 ACCTTTCAGCAGAAGGGAAGGGG + Intronic
984642324 4:182181346-182181368 CTCTTTCAGCAGAAGATTTGGGG - Intronic
985547771 5:518705-518727 CCATTTCTGCAGTAGACATGAGG + Intronic
985792715 5:1939155-1939177 CCCTTACAGAAGAAGCCTGGGGG - Intergenic
985814788 5:2118666-2118688 CCCTTGCTGGAGAACACAGGAGG - Intergenic
986161572 5:5234267-5234289 CCTTGTCACCAGAAGACTGGTGG + Intronic
986376008 5:7131602-7131624 TGCTTTCAGCAGAGGCCAGGTGG - Intergenic
986493718 5:8320291-8320313 GCCTTTCAGGAGGAGGCAGGTGG - Intergenic
986501392 5:8403624-8403646 GCCTGTCATCAGAAGACAGAAGG - Intergenic
986875124 5:12098047-12098069 GCCTGTCAGAGGAAGACAGGGGG - Intergenic
987199653 5:15563090-15563112 CCTTTCCAGCAGAAGACATATGG - Intronic
990483841 5:56237834-56237856 CCAATTTGGCAGAAGACAGGTGG + Intergenic
992309279 5:75478630-75478652 CCCTTCTAGCAGAAGACTAGAGG + Intronic
993638277 5:90371488-90371510 CCCTTTCATCAAAGGACTGGAGG - Intergenic
996814965 5:127564499-127564521 TCCTTTCAGCAGCAGAAATGGGG - Intergenic
996831498 5:127745137-127745159 TCCTGTCTGCAGAAGACAGATGG - Intergenic
1000369482 5:160520913-160520935 CCCTTGCAGCAGAAGAGGGAAGG - Intergenic
1003110380 6:3247991-3248013 CCGTTTCAGCAGGAGAGAGACGG + Intronic
1006008712 6:31024574-31024596 CCCTGTCAGCAAAAGAAATGTGG + Intronic
1006995429 6:38255572-38255594 TGCTTGCAGCAGAAGATAGGAGG - Intronic
1008246356 6:49178739-49178761 CTCCTTCAGCAGAAGAAAGATGG - Intergenic
1009715304 6:67385219-67385241 CCCTATCAGCAGCAGAGAGTGGG + Intergenic
1009723512 6:67506565-67506587 CCCTTCCATCATAAGCCAGGAGG - Intergenic
1011442017 6:87397673-87397695 CCCTTTCTGCAGACCACAGAAGG - Exonic
1011749811 6:90443746-90443768 CCCTGTCACCAAAACACAGGTGG - Intergenic
1013079779 6:106802039-106802061 CCTTCCCAGCAGAAGGCAGGAGG - Intergenic
1013541567 6:111115843-111115865 CCCTTTCATCTGGTGACAGGAGG - Intronic
1013853588 6:114544107-114544129 CCCTTACAGCCAAAGACAGGGGG + Intergenic
1015129783 6:129796213-129796235 CTCTTTCAGCAGAAGAGTGGGGG - Intergenic
1016407266 6:143743682-143743704 CACTTTCAACACAAGACAAGTGG + Intronic
1016594950 6:145788642-145788664 TCCTTTCAGCAGAAGAGGGATGG - Intergenic
1018218117 6:161550662-161550684 CCGTTTCCTGAGAAGACAGGAGG + Intronic
1019032187 6:169023426-169023448 TCCTTTCAGCAGAGGCCACGTGG + Intergenic
1019117020 6:169773449-169773471 GCATCTCTGCAGAAGACAGGTGG - Intronic
1019578602 7:1749359-1749381 CCCTTACAGCAGAAGCCCAGGGG + Intergenic
1020497646 7:8876286-8876308 CCCTTTCAGCAGAAGAGGACAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021722355 7:23516633-23516655 CCCTTTCCTCAGAAGCAAGGAGG - Intronic
1024163801 7:46709260-46709282 CCCTTTCAGCAGAAGACAGGTGG - Intronic
1024259097 7:47560553-47560575 CCCTGACAGCAGCAGAGAGGTGG - Intronic
1026227641 7:68456781-68456803 CACTTACAGCTGAAAACAGGTGG - Intergenic
1029127765 7:98306541-98306563 CCCTATCAGCAGTAGACATGTGG + Intronic
1031201719 7:118696996-118697018 CCCTTTCAGCAGAAGAGGCATGG - Intergenic
1035840914 8:2811172-2811194 CCCTTTCAGGAGATGGCTGGAGG - Intergenic
1037753870 8:21699253-21699275 CCCATCCAGGAGCAGACAGGAGG + Intronic
1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG + Intronic
1038521516 8:28236245-28236267 CCCTTCCAGCAGGAGAAGGGAGG - Intergenic
1039018134 8:33175615-33175637 CCCTTTCTGCAAAGGACAGTGGG + Intergenic
1039813923 8:41075247-41075269 CCCTTTTGGGAGAAGACTGGGGG + Intergenic
1042732669 8:71954593-71954615 CTCTTTCAGCACAAGAGAGAAGG - Intronic
1048697268 8:137041681-137041703 CCCTTTGAGGAGGAGACAGGTGG + Intergenic
1049177041 8:141200139-141200161 CCCTTTCAGAAGAATAGAAGAGG + Intergenic
1049203756 8:141353907-141353929 CCCTGGCCACAGAAGACAGGCGG + Intergenic
1049281390 8:141749005-141749027 CCATTACAGCAGAAGTTAGGAGG + Intergenic
1051957410 9:22713019-22713041 CCCTCTCATCACAAGACTGGAGG + Intergenic
1052168519 9:25364196-25364218 CCCTTTTAGCAGAAGAAAGATGG - Intergenic
1052981593 9:34454135-34454157 TCCTTTCATAAGAAGACAGGAGG + Intronic
1054755569 9:68954102-68954124 CCATTCCAACAGAAGACTGGAGG - Intronic
1054804781 9:69387258-69387280 GCCTTTCTCCAGAAGAAAGGGGG + Intronic
1055467059 9:76576393-76576415 CCCTTTCAAAAGAAGAAATGAGG + Intergenic
1056319296 9:85421337-85421359 CCCCTACAACAGAATACAGGAGG + Intergenic
1056543567 9:87594813-87594835 CCCTTTCACCAGTAGCCAGAAGG + Intronic
1057840892 9:98484947-98484969 CCCTTTCAGCATAAGAGAATGGG - Intronic
1058320680 9:103626900-103626922 CCTTTTGAGCACAAGTCAGGAGG - Intergenic
1058560235 9:106220760-106220782 TCCTTTGGGCAAAAGACAGGAGG - Intergenic
1058717997 9:107739553-107739575 GCCTTTGAGCAGAGGACTGGAGG + Intergenic
1059775287 9:117468650-117468672 CCATTTCAGCAGAGCATAGGAGG - Intergenic
1060601263 9:124879539-124879561 GTCCTTCAGTAGAAGACAGGTGG + Exonic
1061321494 9:129833489-129833511 CCCTTTCAGATGAAGACAGGTGG - Exonic
1061734474 9:132644166-132644188 CCTTTGCAGTGGAAGACAGGAGG - Intronic
1186170898 X:6875468-6875490 TCCTTTCTGCAGAAAACAGCTGG - Intergenic
1187449925 X:19387236-19387258 AACTTCCAGCAGCAGACAGGGGG + Intronic
1187598364 X:20799981-20800003 CCCTCCCATCACAAGACAGGAGG + Intergenic
1188007335 X:25024494-25024516 CCCTTTGAGAGGAAAACAGGAGG - Intergenic
1188441477 X:30218252-30218274 CCCAAACACCAGAAGACAGGAGG + Intronic
1188734980 X:33702154-33702176 CCATTTCAATAGAAGACAGGAGG + Intergenic
1192220898 X:69196736-69196758 CCCCCTCAGCAGATGGCAGGGGG - Intergenic
1192990307 X:76446356-76446378 CACTTTCAGCATTAGACAGATGG - Intergenic
1193347683 X:80423398-80423420 CGCTTTCTGCAGCAGACAGTGGG + Intronic
1195247073 X:103004551-103004573 CCCTTTCCCCAGCAGACAGATGG + Intergenic
1195554174 X:106202491-106202513 CACTATTGGCAGAAGACAGGGGG - Intronic
1195694025 X:107653545-107653567 CACTTTCAGCAGAAAACACTTGG + Intergenic
1197926368 X:131650764-131650786 CCCTTTCTGCAGTAGGCAGCAGG + Intergenic
1198265477 X:135004608-135004630 CGGTTTCTGCATAAGACAGGTGG - Intergenic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic