ID: 1024165044

View in Genome Browser
Species Human (GRCh38)
Location 7:46722635-46722657
Sequence CTCAGACAGACGTGGAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024165044 Original CRISPR CTCAGACAGACGTGGAGCCT TGG Intronic
900346850 1:2214290-2214312 CTCAGGCTTACGAGGAGCCTGGG + Intergenic
900641458 1:3689827-3689849 CTCAGACAAACCTGGGGACTGGG - Intronic
901508306 1:9700633-9700655 TACAGACAGATGTGGAGCCGGGG - Intronic
904385684 1:30140593-30140615 CTCACACAGGCCTGGAGCCTGGG + Intergenic
905534943 1:38713998-38714020 CTCAGACTGAAATGGGGCCTGGG - Intergenic
907847125 1:58219148-58219170 CGTAGACAGAGGAGGAGCCTTGG - Intronic
912551356 1:110487491-110487513 CTGAGCCAGGCCTGGAGCCTGGG + Intergenic
912821256 1:112869697-112869719 CTCAGACCGACTTGGTTCCTTGG - Intergenic
913451941 1:118998600-118998622 CCCAGACAGAGGTGCAGCCAAGG - Intergenic
914980671 1:152411810-152411832 CTCAGACAGGAGCAGAGCCTTGG - Intronic
915648876 1:157293307-157293329 CTCAGAAAGAGGTGGAGCTGAGG - Intergenic
915669725 1:157478600-157478622 CTCAGACAGGCCTGGATTCTGGG + Intergenic
916010619 1:160702319-160702341 CTGAGACAGAAGTAGAGGCTGGG + Intronic
918950113 1:191125994-191126016 CTCAGGAAGATGGGGAGCCTTGG - Intergenic
919617841 1:199829805-199829827 AGCATACAGACCTGGAGCCTGGG - Intergenic
920094866 1:203479858-203479880 CTCACACAGATGAGGAGCCCGGG + Intronic
923114161 1:230918745-230918767 CCCAGGCAGATGTGGGGCCTGGG + Intronic
923503527 1:234586079-234586101 CTCAGCCCGACCTGGACCCTCGG + Intergenic
923537607 1:234865023-234865045 CTCAGAGAGACGTGGGGCAGAGG - Intergenic
923671044 1:236041750-236041772 CTCTCACAGCCGTGGAGCCTTGG - Intronic
1064647390 10:17473404-17473426 CTCACACAGATGTTGAACCTTGG - Intergenic
1067146598 10:43698744-43698766 CTCAGCAAGAAGAGGAGCCTGGG - Intergenic
1067662067 10:48243634-48243656 GTGAGACACACCTGGAGCCTAGG - Intronic
1067773847 10:49147070-49147092 CTCAAAAAGAAGTTGAGCCTGGG - Intergenic
1070574563 10:77667776-77667798 CTCATTGAGACATGGAGCCTGGG - Intergenic
1070658321 10:78286362-78286384 CTCAGACAGAGGAGGAGTTTGGG - Intergenic
1071417392 10:85454005-85454027 CACAGAGAGACTTGGAGGCTTGG - Intergenic
1072574966 10:96691029-96691051 CTCAGAGATACCTGGAGCCAAGG - Intronic
1077300872 11:1846362-1846384 CCCAGACAGCCCTGGAGCCCAGG + Intergenic
1077395376 11:2317915-2317937 CTCAGACTGACGTCAGGCCTTGG + Exonic
1079019425 11:16896792-16896814 CTGAGACACCCCTGGAGCCTGGG - Intronic
1079097675 11:17521316-17521338 CACAGACACGCGTGGAGCCGAGG + Intronic
1083255825 11:61494902-61494924 CCAAGACAGAGGTGGAGACTTGG + Intergenic
1084669390 11:70596296-70596318 CACAGGCAGACCTGGCGCCTGGG + Intronic
1085196990 11:74678803-74678825 CTCAGACAGACTGTGAGCCCTGG + Intergenic
1085349137 11:75787355-75787377 ACCAAACAGACCTGGAGCCTTGG - Intronic
1085523992 11:77153851-77153873 CTGAGACACACGGGGAGGCTGGG - Intronic
1085798622 11:79566606-79566628 CTCAGTCAGACAAGGACCCTGGG + Intergenic
1089455479 11:118623177-118623199 CTCAGACTGGCGTGAAGCTTGGG + Intronic
1090650938 11:128805379-128805401 CTCAGTCAGAAGAGGAGCTTGGG + Exonic
1093690544 12:22103458-22103480 CTCAGGCACATGTGGAGCCCTGG - Intronic
1094327184 12:29253119-29253141 CTCACACAGTTGTGGAGGCTTGG - Intronic
1095947139 12:47759640-47759662 CCCAGGGAGGCGTGGAGCCTCGG - Intronic
1098518199 12:71403049-71403071 CTGGGAAAGACCTGGAGCCTGGG - Intronic
1100411475 12:94323275-94323297 CTCAGATACACGTAGAGCCCTGG - Intronic
1103038294 12:117674019-117674041 CTAACACAGATGTGCAGCCTTGG - Intronic
1103816190 12:123658563-123658585 CTCAAACAGTCCTGAAGCCTTGG + Intronic
1106048650 13:26169241-26169263 CTCAGGGAGCCGTGGAGACTAGG + Intronic
1106433989 13:29707991-29708013 TGCAGACAGAGGTGGAGCCGGGG - Intergenic
1109683432 13:65783593-65783615 CTCACACAGACCTGGCACCTGGG - Intergenic
1110914343 13:81002707-81002729 CTCAGACAGTCCTCCAGCCTTGG - Intergenic
1113401930 13:110002306-110002328 CTGAGAATGACATGGAGCCTGGG + Intergenic
1113527218 13:110990085-110990107 CCCAGAGACACGCGGAGCCTGGG - Intergenic
1113598021 13:111548048-111548070 CTCCGACAGACGGGGAGCCGGGG + Intergenic
1115517673 14:34202279-34202301 CTCTGACAGAAGTGGTGGCTGGG - Intronic
1117820499 14:59644492-59644514 CTCAGGCACACGTGGAGCCCCGG + Intronic
1121270600 14:92635269-92635291 CTGTGACAAAGGTGGAGCCTGGG - Intronic
1129316573 15:74748964-74748986 GACAGAAAGACGGGGAGCCTGGG + Intronic
1132801260 16:1755171-1755193 CCAAGACAGACCTGGAGCCATGG + Intronic
1133023683 16:2978138-2978160 CTCAGACAGAGATTTAGCCTAGG + Intronic
1137628162 16:49922554-49922576 CTCAGAAAGGCCTGGAGCCCAGG + Intergenic
1138430345 16:56964500-56964522 CTCAGGCTGCCCTGGAGCCTGGG + Intronic
1138719407 16:59061524-59061546 CTCAGGAAGACCTGGAGCCCAGG + Intergenic
1142536944 17:624707-624729 CTCAGTGAGAAATGGAGCCTGGG - Intronic
1144667023 17:17108867-17108889 CTCAGGCAGACTTGGAGACCAGG + Intronic
1145736708 17:27238192-27238214 CTCAGCCCCACGTGGAGCCTAGG + Intergenic
1146536255 17:33655158-33655180 ACCAGACAGACCTGGTGCCTCGG + Intronic
1147690810 17:42313234-42313256 CTCACACACAGGTGGGGCCTGGG - Intergenic
1149774665 17:59347877-59347899 TTCAGACAGACATGGAGTTTGGG - Intronic
1151692872 17:75697695-75697717 CTGAGACAGGAGTCGAGCCTGGG - Intronic
1152797588 17:82315734-82315756 CTCAGACAGACACAGAGTCTAGG - Intronic
1162838770 19:13340304-13340326 AACAGACACACGTGGAGGCTTGG + Intronic
1163118505 19:15201742-15201764 CTCAGCCAGGCCAGGAGCCTAGG + Intergenic
1165106456 19:33472468-33472490 CTCAAACAGACAGGGAGGCTGGG + Intronic
1165447959 19:35867023-35867045 CTCAGAAAGACTTGGACCCAAGG + Exonic
1166943729 19:46384468-46384490 CTCAGAGAGGCCTGGAGCCATGG - Intronic
1167845695 19:52162362-52162384 CTCAGAGATCCTTGGAGCCTAGG - Intronic
1167852690 19:52214046-52214068 GACAGACAGATGTGGGGCCTTGG + Intronic
925276364 2:2651081-2651103 CTCAGAGATGCGGGGAGCCTGGG - Intergenic
925864364 2:8213259-8213281 CTGAGACAGACGGGGAGCAAAGG + Intergenic
926625355 2:15085776-15085798 CTCAGAGAAACGTGGAGCAGGGG + Intergenic
930799566 2:55429023-55429045 CCCTGAAAGACCTGGAGCCTTGG + Intergenic
933085928 2:78053747-78053769 CTGGGAGCGACGTGGAGCCTGGG - Intergenic
936233007 2:110720470-110720492 CTCAGAAAGATGTGGAGCCGAGG - Intergenic
939994014 2:148903096-148903118 ATCAGAAAGATGGGGAGCCTCGG + Intronic
943090642 2:183370512-183370534 TTCTGACAGATTTGGAGCCTGGG + Intergenic
944431079 2:199634226-199634248 CTCACACAGAAGTTTAGCCTGGG + Intergenic
945055900 2:205868793-205868815 CCCAGACACAGGTGGATCCTGGG - Intergenic
948456548 2:238107136-238107158 CTGGGACAGACATGGGGCCTGGG - Intronic
1168998171 20:2147755-2147777 CCCAGACAGACGTAGCTCCTGGG + Exonic
1171317092 20:24204845-24204867 CTCAGGCAGACGCGGATCCTAGG + Intergenic
1175406880 20:58740754-58740776 ATCAGACAGACGTGGACTCAAGG + Intergenic
1175793809 20:61758699-61758721 CCCAGACAGACATGGAGCTGGGG - Intronic
1176241403 20:64077398-64077420 CACAGACAGACCTGGACTCTTGG - Intronic
1177893870 21:26838569-26838591 CACAGACAGAGGTGGAATCTGGG + Exonic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178214949 21:30585142-30585164 CTCATACAGCTGTGGAGGCTCGG + Intergenic
1179082609 21:38186931-38186953 CTCACACAGACATGAAACCTTGG + Intronic
1179159401 21:38880084-38880106 CTCACACAGACATGAAACCTTGG - Intergenic
1179536941 21:42058978-42059000 CCCAGGCTGACGTGGACCCTGGG + Intergenic
1180063912 21:45403475-45403497 GCCAGACAGACCAGGAGCCTCGG + Intergenic
1184445367 22:44544090-44544112 CTGAGGCAGAAATGGAGCCTGGG - Intergenic
1184846381 22:47090333-47090355 CTCAGACAGACGGGGCGTCTTGG + Intronic
949685795 3:6568589-6568611 CTGAGACTGACTTGGAGCTTAGG - Intergenic
955841348 3:63116407-63116429 TTCAGTCAGATGTGGAGCTTAGG - Intergenic
959480548 3:106867034-106867056 ATGAGACAGACGAGGAGGCTGGG - Intergenic
961304801 3:125951071-125951093 CTCAAACAGAAGTGCAGCCCTGG - Intergenic
961521814 3:127471406-127471428 GTCAGACAGAGGTGGGGACTGGG + Intergenic
963069369 3:141290323-141290345 GTCAGACAGACCTGTAGCATGGG + Intronic
963756879 3:149243652-149243674 CACAGACAGAGGTGGGGCTTGGG - Intergenic
965498490 3:169428438-169428460 ATCTGACAGAGGTGGAGCTTAGG + Intronic
969210674 4:5684850-5684872 CTAGGACAGACGTGCAGCCAGGG + Intronic
969496877 4:7531304-7531326 CTCACACAGGTGTGGAGCTTAGG - Intronic
975042883 4:69766493-69766515 CTCAGACAAACCTGGAGGATGGG + Intronic
978980639 4:114940924-114940946 CTCTGCCAGTGGTGGAGCCTGGG + Intronic
979546975 4:121950863-121950885 CACAGAGAGACGAGGCGCCTGGG + Intronic
979568288 4:122182531-122182553 GTCAGACAGATGTGGAGCGGAGG - Intronic
980517234 4:133878543-133878565 CTGAGAGTGACATGGAGCCTGGG - Intergenic
981972608 4:150683567-150683589 CACAGACAAGCATGGAGCCTGGG - Exonic
983831236 4:172330214-172330236 CTCAGGCACAGGTGGAGCCCTGG - Intronic
983894835 4:173070823-173070845 CTAGGTCAGACATGGAGCCTGGG + Intergenic
984993020 4:185399715-185399737 CTCAGACAGAAACGGAGTCTCGG + Exonic
985018475 4:185661900-185661922 CTCAGACACAGGTGGAGACATGG + Intronic
986183030 5:5411269-5411291 CTCTTACAGACGTGGAGACTTGG - Intergenic
991965226 5:72084142-72084164 ATCAGACAGGCCTGAAGCCTGGG + Intergenic
992488709 5:77220171-77220193 CTCAGTCACATGTGGAGCCCAGG + Intronic
993880775 5:93358188-93358210 ATCAGACAGGCATGGAGCCTTGG - Intergenic
996302693 5:122007685-122007707 CTGGGACAGACCTGGACCCTGGG + Intronic
996302762 5:122008000-122008022 CTGAGGCAGACCTGGACCCTGGG + Intronic
997646650 5:135486538-135486560 CACAGCCAGAAATGGAGCCTGGG - Intergenic
997744076 5:136283470-136283492 CTCATGCAGGCCTGGAGCCTGGG - Intronic
999436893 5:151570295-151570317 CTCAGACATTCCAGGAGCCTGGG - Intergenic
1003311699 6:4974556-4974578 CTCAGCCAGACCAGCAGCCTCGG - Intergenic
1007296812 6:40829519-40829541 ATCTGACAGAGGTGGAGCCCAGG + Intergenic
1007429595 6:41769047-41769069 TTCAGACAGAAATGGAGTCTTGG + Intergenic
1007961292 6:45962262-45962284 CTCACACAGTTGTGGAGGCTTGG + Intronic
1008859035 6:56127025-56127047 CTCAAAGAGATGTGGAGCTTTGG - Intronic
1008977881 6:57449027-57449049 TTCAGACAGATGGGGAGCTTAGG + Intronic
1009166027 6:60341974-60341996 TTCAGACAGATGGGGAGCTTAGG + Intergenic
1010665960 6:78629874-78629896 CTCAGGCACATGTGGAGCCCAGG - Intergenic
1010986612 6:82432515-82432537 CTCAGGCTGAGGTGGAGCGTGGG + Intergenic
1017718271 6:157227235-157227257 CACACACACACGTGGAGACTGGG + Intergenic
1018900455 6:168049368-168049390 CTCTCACAGACGTGGACCTTTGG + Intergenic
1023866168 7:44239379-44239401 CTCTTACAGGCGAGGAGCCTTGG + Intronic
1023926789 7:44675321-44675343 CTAAGAAAGAAGTGGAGCCAGGG - Intronic
1024165044 7:46722635-46722657 CTCAGACAGACGTGGAGCCTTGG + Intronic
1028924839 7:96346713-96346735 CTGAGACCCACGTGGAGCCTCGG - Intergenic
1035891886 8:3354009-3354031 AACAGACAGACGTGGAGGCTAGG + Intronic
1038632347 8:29258083-29258105 CACTGACAGATGTGGAGCCAAGG - Intronic
1039970906 8:42320883-42320905 CACAGACAGCCCTGGAGCTTCGG + Intronic
1040562157 8:48532772-48532794 CTCAGGCAGATGAGGAGCCCTGG - Intergenic
1050697621 9:8297025-8297047 CTCAGACAGATGAAAAGCCTGGG + Intergenic
1051486290 9:17612042-17612064 CTCAGAGAGAGGAGGTGCCTGGG + Intronic
1051868637 9:21711160-21711182 CTCACACAGTTGTGGAGGCTTGG + Intergenic
1052698567 9:31909993-31910015 CTAAGACACACCTGGAACCTGGG + Intergenic
1059422476 9:114200910-114200932 CACAGGCGGAGGTGGAGCCTCGG + Intronic
1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG + Intronic
1062065060 9:134522241-134522263 CCCAGACAGAGGTGGAGACCTGG - Intergenic
1186894831 X:13995227-13995249 CTCAGAAAGACTTGAAACCTGGG + Intergenic
1191991504 X:67041770-67041792 CTTATACAGACATGGACCCTGGG + Intergenic
1192382757 X:70635643-70635665 CTGAGGCAGACCTGAAGCCTGGG - Intronic
1194947869 X:100090871-100090893 CTCAGGCACACTTGGAGACTTGG + Intergenic
1195104930 X:101594249-101594271 TTCAGACACACGTGGAGACCAGG - Intergenic
1196228169 X:113189960-113189982 CTCAAGCACACGTGGAGACTGGG - Intergenic
1197461560 X:126749145-126749167 CTCAGGCAGAGGCGGAGCCAAGG + Intergenic