ID: 1024173989

View in Genome Browser
Species Human (GRCh38)
Location 7:46819475-46819497
Sequence TGACCTCTGTTGACACCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024173989_1024173991 -9 Left 1024173989 7:46819475-46819497 CCCACTGGTGTCAACAGAGGTCA No data
Right 1024173991 7:46819489-46819511 CAGAGGTCAAGTCACAAACCTGG No data
1024173989_1024173993 9 Left 1024173989 7:46819475-46819497 CCCACTGGTGTCAACAGAGGTCA No data
Right 1024173993 7:46819507-46819529 CCTGGACTTTCACCTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024173989 Original CRISPR TGACCTCTGTTGACACCAGT GGG (reversed) Intergenic
No off target data available for this crispr