ID: 1024177023

View in Genome Browser
Species Human (GRCh38)
Location 7:46851014-46851036
Sequence ACTCCTGCTTGGAGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024177023_1024177025 -8 Left 1024177023 7:46851014-46851036 CCTTCAGGGCTCCAAGCAGGAGT No data
Right 1024177025 7:46851029-46851051 GCAGGAGTGTCCAATGAGCAAGG No data
1024177023_1024177026 1 Left 1024177023 7:46851014-46851036 CCTTCAGGGCTCCAAGCAGGAGT No data
Right 1024177026 7:46851038-46851060 TCCAATGAGCAAGGCATCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024177023 Original CRISPR ACTCCTGCTTGGAGCCCTGA AGG (reversed) Intergenic