ID: 1024179354

View in Genome Browser
Species Human (GRCh38)
Location 7:46874424-46874446
Sequence TGCAATCATCTGGATGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024179351_1024179354 11 Left 1024179351 7:46874390-46874412 CCTCAGCCATAAAAAGGAATGAA No data
Right 1024179354 7:46874424-46874446 TGCAATCATCTGGATGAGATCGG No data
1024179352_1024179354 5 Left 1024179352 7:46874396-46874418 CCATAAAAAGGAATGAATCAACA No data
Right 1024179354 7:46874424-46874446 TGCAATCATCTGGATGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024179354 Original CRISPR TGCAATCATCTGGATGAGAT CGG Intergenic
No off target data available for this crispr