ID: 1024184856

View in Genome Browser
Species Human (GRCh38)
Location 7:46939674-46939696
Sequence GAGACTCGTGTGATCAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024184856_1024184863 28 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG No data
1024184856_1024184859 17 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184859 7:46939714-46939736 TCTCCAGCTGACGGCAGAAGAGG No data
1024184856_1024184862 27 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184862 7:46939724-46939746 ACGGCAGAAGAGGAAGTTGGAGG No data
1024184856_1024184858 8 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184858 7:46939705-46939727 AGGAGCTTCTCTCCAGCTGACGG No data
1024184856_1024184861 24 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184861 7:46939721-46939743 CTGACGGCAGAAGAGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024184856 Original CRISPR GAGACTCGTGTGATCAAATC AGG (reversed) Intergenic
No off target data available for this crispr