ID: 1024184863

View in Genome Browser
Species Human (GRCh38)
Location 7:46939725-46939747
Sequence CGGCAGAAGAGGAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024184856_1024184863 28 Left 1024184856 7:46939674-46939696 CCTGATTTGATCACACGAGTCTC No data
Right 1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024184863 Original CRISPR CGGCAGAAGAGGAAGTTGGA GGG Intergenic
No off target data available for this crispr