ID: 1024186090

View in Genome Browser
Species Human (GRCh38)
Location 7:46949471-46949493
Sequence CTCACGAGGTGGGTGTCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024186090_1024186096 1 Left 1024186090 7:46949471-46949493 CCCTTCGACACCCACCTCGTGAG No data
Right 1024186096 7:46949495-46949517 CCTCTGCCTCTTCTGCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024186090 Original CRISPR CTCACGAGGTGGGTGTCGAA GGG (reversed) Intergenic
No off target data available for this crispr