ID: 1024186879

View in Genome Browser
Species Human (GRCh38)
Location 7:46958472-46958494
Sequence CTGTATACTCAGAAAGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024186872_1024186879 10 Left 1024186872 7:46958439-46958461 CCTTATACCTACAAGAAGTAAAG No data
Right 1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG No data
1024186876_1024186879 3 Left 1024186876 7:46958446-46958468 CCTACAAGAAGTAAAGCAGGGGT No data
Right 1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024186879 Original CRISPR CTGTATACTCAGAAAGATCA GGG Intergenic
No off target data available for this crispr