ID: 1024190069

View in Genome Browser
Species Human (GRCh38)
Location 7:46997106-46997128
Sequence TGGATTAATGAGGTTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024190069_1024190082 27 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190082 7:46997156-46997178 TGGGGAAGGGCAGGAAAACTAGG No data
1024190069_1024190072 -10 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190072 7:46997119-46997141 CATTAATCCAACAAGTTTCTGGG No data
1024190069_1024190074 7 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190074 7:46997136-46997158 TCTGGGCCCTGTAGTCTGAGTGG No data
1024190069_1024190081 18 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190081 7:46997147-46997169 TAGTCTGAGTGGGGAAGGGCAGG No data
1024190069_1024190075 8 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190075 7:46997137-46997159 CTGGGCCCTGTAGTCTGAGTGGG No data
1024190069_1024190080 14 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190080 7:46997143-46997165 CCTGTAGTCTGAGTGGGGAAGGG No data
1024190069_1024190076 9 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190076 7:46997138-46997160 TGGGCCCTGTAGTCTGAGTGGGG No data
1024190069_1024190078 13 Left 1024190069 7:46997106-46997128 CCTTCTACAACCTCATTAATCCA No data
Right 1024190078 7:46997142-46997164 CCCTGTAGTCTGAGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024190069 Original CRISPR TGGATTAATGAGGTTGTAGA AGG (reversed) Intergenic
No off target data available for this crispr