ID: 1024194508

View in Genome Browser
Species Human (GRCh38)
Location 7:47045842-47045864
Sequence CCTCACTTGCAAAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024194502_1024194508 23 Left 1024194502 7:47045796-47045818 CCTCGTACTTGGTGCCTGAGATT No data
Right 1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG No data
1024194501_1024194508 26 Left 1024194501 7:47045793-47045815 CCACCTCGTACTTGGTGCCTGAG No data
Right 1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG No data
1024194504_1024194508 -6 Left 1024194504 7:47045825-47045847 CCTTCTCAAGCCTGTTTCCTCAC No data
Right 1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG No data
1024194503_1024194508 9 Left 1024194503 7:47045810-47045832 CCTGAGATTACTTCACCTTCTCA No data
Right 1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024194508 Original CRISPR CCTCACTTGCAAAATGAGGA TGG Intergenic
No off target data available for this crispr