ID: 1024197276

View in Genome Browser
Species Human (GRCh38)
Location 7:47071542-47071564
Sequence TGGCATTCACTGAGAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024197273_1024197276 10 Left 1024197273 7:47071509-47071531 CCGGGAAGGTCAAACTGGCTCTC No data
Right 1024197276 7:47071542-47071564 TGGCATTCACTGAGAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024197276 Original CRISPR TGGCATTCACTGAGAATAAA AGG Intergenic
No off target data available for this crispr