ID: 1024201048

View in Genome Browser
Species Human (GRCh38)
Location 7:47106046-47106068
Sequence GTGAGCAGTGCTCACACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024201042_1024201048 9 Left 1024201042 7:47106014-47106036 CCTGGACGTTTTTGCACCCTGTG No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data
1024201040_1024201048 20 Left 1024201040 7:47106003-47106025 CCTGCAACGACCCTGGACGTTTT No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data
1024201041_1024201048 10 Left 1024201041 7:47106013-47106035 CCCTGGACGTTTTTGCACCCTGT No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data
1024201038_1024201048 28 Left 1024201038 7:47105995-47106017 CCAGCTCTCCTGCAACGACCCTG No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data
1024201047_1024201048 -8 Left 1024201047 7:47106031-47106053 CCTGTGGCTGACAGGGTGAGCAG No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data
1024201046_1024201048 -7 Left 1024201046 7:47106030-47106052 CCCTGTGGCTGACAGGGTGAGCA No data
Right 1024201048 7:47106046-47106068 GTGAGCAGTGCTCACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024201048 Original CRISPR GTGAGCAGTGCTCACACAGC TGG Intergenic
No off target data available for this crispr