ID: 1024207134

View in Genome Browser
Species Human (GRCh38)
Location 7:47173395-47173417
Sequence CAGTCTCAGAAGCTGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024207134_1024207137 0 Left 1024207134 7:47173395-47173417 CCTGTGTCCAGCTTCTGAGACTG No data
Right 1024207137 7:47173418-47173440 AAGACCTCATGCCAGAGATTGGG No data
1024207134_1024207139 9 Left 1024207134 7:47173395-47173417 CCTGTGTCCAGCTTCTGAGACTG No data
Right 1024207139 7:47173427-47173449 TGCCAGAGATTGGGCTAACAAGG No data
1024207134_1024207136 -1 Left 1024207134 7:47173395-47173417 CCTGTGTCCAGCTTCTGAGACTG No data
Right 1024207136 7:47173417-47173439 GAAGACCTCATGCCAGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024207134 Original CRISPR CAGTCTCAGAAGCTGGACAC AGG (reversed) Intergenic
No off target data available for this crispr