ID: 1024207793

View in Genome Browser
Species Human (GRCh38)
Location 7:47178647-47178669
Sequence ACAGAGAAGAAACATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024207791_1024207793 14 Left 1024207791 7:47178610-47178632 CCTATGTGTTTTGTCAATTTAGA No data
Right 1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024207793 Original CRISPR ACAGAGAAGAAACATGAGAA AGG Intergenic
No off target data available for this crispr