ID: 1024208306

View in Genome Browser
Species Human (GRCh38)
Location 7:47182612-47182634
Sequence CTGGGGTTCCAGTGAGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024208306_1024208319 11 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208319 7:47182646-47182668 GGACCACAGACACTGAGTGATGG No data
1024208306_1024208325 30 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208325 7:47182665-47182687 ATGGTACAGGAAGAGGAAAGGGG No data
1024208306_1024208323 28 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208323 7:47182663-47182685 TGATGGTACAGGAAGAGGAAAGG No data
1024208306_1024208324 29 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208324 7:47182664-47182686 GATGGTACAGGAAGAGGAAAGGG No data
1024208306_1024208314 -10 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208314 7:47182625-47182647 GGAACCCCAGGCCAGGGGTGGGG No data
1024208306_1024208322 23 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208322 7:47182658-47182680 CTGAGTGATGGTACAGGAAGAGG No data
1024208306_1024208321 17 Left 1024208306 7:47182612-47182634 CCCACGACTCACTGGAACCCCAG No data
Right 1024208321 7:47182652-47182674 CAGACACTGAGTGATGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024208306 Original CRISPR CTGGGGTTCCAGTGAGTCGT GGG (reversed) Intergenic
No off target data available for this crispr