ID: 1024208462

View in Genome Browser
Species Human (GRCh38)
Location 7:47183652-47183674
Sequence CAGTGGGAGTAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024208457_1024208462 -6 Left 1024208457 7:47183635-47183657 CCATCTGACCAGGGGAGCAGTGG No data
Right 1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG No data
1024208452_1024208462 12 Left 1024208452 7:47183617-47183639 CCTGAGCCTTCTAATGGGCCATC No data
Right 1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG No data
1024208451_1024208462 13 Left 1024208451 7:47183616-47183638 CCCTGAGCCTTCTAATGGGCCAT No data
Right 1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG No data
1024208448_1024208462 18 Left 1024208448 7:47183611-47183633 CCATTCCCTGAGCCTTCTAATGG No data
Right 1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG No data
1024208453_1024208462 6 Left 1024208453 7:47183623-47183645 CCTTCTAATGGGCCATCTGACCA No data
Right 1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024208462 Original CRISPR CAGTGGGAGTAGAGAGAAGT GGG Intergenic
No off target data available for this crispr