ID: 1024222625

View in Genome Browser
Species Human (GRCh38)
Location 7:47300471-47300493
Sequence TGGAAGGTACCTGCCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024222625_1024222629 7 Left 1024222625 7:47300471-47300493 CCAGCAAGGGCAGGTACCTTCCA No data
Right 1024222629 7:47300501-47300523 CTGCTCTCAGCAAACCCCCGCGG No data
1024222625_1024222630 11 Left 1024222625 7:47300471-47300493 CCAGCAAGGGCAGGTACCTTCCA No data
Right 1024222630 7:47300505-47300527 TCTCAGCAAACCCCCGCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024222625 Original CRISPR TGGAAGGTACCTGCCCTTGC TGG (reversed) Intronic