ID: 1024222625 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:47300471-47300493 |
Sequence | TGGAAGGTACCTGCCCTTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024222625_1024222629 | 7 | Left | 1024222625 | 7:47300471-47300493 | CCAGCAAGGGCAGGTACCTTCCA | No data | ||
Right | 1024222629 | 7:47300501-47300523 | CTGCTCTCAGCAAACCCCCGCGG | No data | ||||
1024222625_1024222630 | 11 | Left | 1024222625 | 7:47300471-47300493 | CCAGCAAGGGCAGGTACCTTCCA | No data | ||
Right | 1024222630 | 7:47300505-47300527 | TCTCAGCAAACCCCCGCGGCAGG | 0: 1 1: 0 2: 0 3: 4 4: 69 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024222625 | Original CRISPR | TGGAAGGTACCTGCCCTTGC TGG (reversed) | Intronic | ||