ID: 1024224230

View in Genome Browser
Species Human (GRCh38)
Location 7:47313567-47313589
Sequence CAGGTACTGCATGCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024224230_1024224233 5 Left 1024224230 7:47313567-47313589 CCCAGCACAGCATGCAGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1024224233 7:47313595-47313617 ATGACTGACATTGCTCTTAGTGG No data
1024224230_1024224234 22 Left 1024224230 7:47313567-47313589 CCCAGCACAGCATGCAGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1024224234 7:47313612-47313634 TAGTGGTTCCCACAAAGCCACGG No data
1024224230_1024224236 24 Left 1024224230 7:47313567-47313589 CCCAGCACAGCATGCAGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1024224236 7:47313614-47313636 GTGGTTCCCACAAAGCCACGGGG 0: 1
1: 0
2: 1
3: 7
4: 105
1024224230_1024224235 23 Left 1024224230 7:47313567-47313589 CCCAGCACAGCATGCAGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1024224235 7:47313613-47313635 AGTGGTTCCCACAAAGCCACGGG 0: 1
1: 0
2: 1
3: 18
4: 139
1024224230_1024224237 25 Left 1024224230 7:47313567-47313589 CCCAGCACAGCATGCAGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 224
Right 1024224237 7:47313615-47313637 TGGTTCCCACAAAGCCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024224230 Original CRISPR CAGGTACTGCATGCTGTGCT GGG (reversed) Intronic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
903214222 1:21834394-21834416 CAGGGAGTGCCTGCTCTGCTGGG - Intronic
903672092 1:25042534-25042556 CAGGAACTACACGCTCTGCTAGG - Intergenic
904141130 1:28354019-28354041 AAGGTACTTCATGCAGTGCTTGG + Intergenic
904467900 1:30718907-30718929 CACGTCCTGCACGCTGTCCTGGG + Exonic
904509984 1:30996878-30996900 CAGGCACTGCAGTCAGTGCTAGG - Intronic
904801338 1:33094808-33094830 TATGCACTGCATGCAGTGCTTGG + Intronic
907203398 1:52747613-52747635 CAGGGACTGCATGTGGTTCTAGG + Intronic
908335826 1:63122210-63122232 CAGGCACTGCGCTCTGTGCTAGG + Intergenic
909351030 1:74653521-74653543 CAGGCACTGAATCCTGAGCTGGG + Intronic
909479286 1:76114162-76114184 TAGGTAATGCATGCTGTTTTAGG - Intronic
911110160 1:94175526-94175548 AAAGGATTGCATGCTGTGCTTGG - Intronic
912178276 1:107187258-107187280 CAAGTACTGCATTGGGTGCTAGG - Intronic
913094893 1:115507166-115507188 CATCTGCTGCGTGCTGTGCTAGG - Intergenic
917880553 1:179331324-179331346 CAGGTACTACATTAAGTGCTGGG + Intronic
921368325 1:214396075-214396097 CAGGTACTCGATTCAGTGCTTGG - Intronic
921571229 1:216781234-216781256 CAGGCACTGTGTGCAGTGCTAGG + Intronic
924623058 1:245679006-245679028 CAGGACCTGCATTCTCTGCTTGG + Intronic
1065788466 10:29237969-29237991 CAGATACTGCCTGGTGGGCTTGG + Intergenic
1066243768 10:33562326-33562348 CAGGGGTTGCATGCTTTGCTGGG - Intergenic
1068009936 10:51435674-51435696 ACTGTACTGGATGCTGTGCTGGG + Intronic
1068793248 10:61049897-61049919 CAGGTACTGCACTCAGTGCTGGG + Intergenic
1070551748 10:77495697-77495719 CAGGCACAGCCTGCCGTGCTGGG + Intronic
1070678169 10:78429307-78429329 CAGAGACTGCACGATGTGCTTGG + Intergenic
1071360330 10:84840055-84840077 GAGGTATTGCATTTTGTGCTGGG + Intergenic
1071488821 10:86122309-86122331 CAGGTACCACATGCTGAGCCAGG + Intronic
1072358904 10:94639859-94639881 CAGATCTTGAATGCTGTGCTGGG + Intergenic
1076823264 10:132952608-132952630 CAGGTACTGCAGGGTGTGGCAGG + Intergenic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1077472637 11:2771182-2771204 CAGGGTCTGCATGCTCTGCTGGG - Intronic
1078058586 11:8029190-8029212 CAGCAACTGCATGCTTTGTTTGG - Intronic
1078481180 11:11677073-11677095 CAGGCTCTGCTTGCTGTGCTGGG - Intergenic
1078636283 11:13053457-13053479 GATCTCCTGCATGCTGTGCTGGG - Intergenic
1081141354 11:39504778-39504800 CAGGTTCTGTGTGCAGTGCTAGG - Intergenic
1082806597 11:57455667-57455689 CACGTGCTGCCTACTGTGCTGGG - Intergenic
1084590246 11:70086027-70086049 CAGGGACGGCATGCTGCGCCAGG - Intronic
1084794359 11:71495178-71495200 GAGGCACTGAATGCAGTGCTAGG - Intronic
1089125671 11:116174806-116174828 CATGTGCTGGAAGCTGTGCTGGG - Intergenic
1090205059 11:124879452-124879474 CAGGTTCTGCCTGCAGTGTTAGG - Exonic
1092238586 12:6824295-6824317 CAGGCACTGCATGCCGTCATGGG + Exonic
1097466182 12:59928046-59928068 CAGGTTCTGAATGCTGGGATGGG - Intergenic
1097945630 12:65365214-65365236 CAGGTGCTGCATTCAGTGTTGGG + Intronic
1099216685 12:79861966-79861988 CAGAGATTGAATGCTGTGCTGGG - Intronic
1102677772 12:114669642-114669664 CAGGGACTGCAGGCTGTGTGGGG + Intergenic
1103745474 12:123120192-123120214 CAGGTCCTGAATGCTCTGGTTGG - Intronic
1103781588 12:123402385-123402407 CAGGCGCTGCAGTCTGTGCTGGG - Intronic
1105913475 13:24892133-24892155 CAGGCACTGCATTAGGTGCTTGG - Intronic
1106100547 13:26692136-26692158 CAAGTATTGCATGATGTGATAGG + Intergenic
1106150960 13:27101493-27101515 CAGGAACTGGATTATGTGCTGGG + Intronic
1107305622 13:39015120-39015142 CAGGTGCTGTGTTCTGTGCTAGG - Intronic
1107412154 13:40167824-40167846 CAAGTACTGAATTCAGTGCTTGG - Intergenic
1108210793 13:48137966-48137988 CAGGTATCACATGCAGTGCTAGG - Intergenic
1108261187 13:48658463-48658485 CATGTGCTTCACGCTGTGCTAGG + Intronic
1108505752 13:51110943-51110965 CAGGTACTGCAGGCAGTCCTGGG + Intergenic
1108757940 13:53526897-53526919 TATGTACTACATACTGTGCTAGG - Intergenic
1109404756 13:61882705-61882727 CAGCTACTACCTACTGTGCTGGG - Intergenic
1112248686 13:97757920-97757942 CAGGCACTTCCTGCTTTGCTAGG + Intergenic
1112567283 13:100562383-100562405 CAGGTACTGCGTGAGGTGCCAGG - Intronic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1113909169 13:113834029-113834051 CAGGTAGGTCATGCTGTGATAGG + Intronic
1113909180 13:113834091-113834113 CAGGTAGGTCATGCTGTGATAGG + Intronic
1114912690 14:27220352-27220374 CAGGTACTGCATGAAGGTCTAGG - Intergenic
1122882657 14:104697018-104697040 CAGGTACTGCCTACTGTGCCTGG - Intronic
1123706118 15:22952217-22952239 CAGGGGCTGCGTGCTGGGCTGGG + Intronic
1123978751 15:25579098-25579120 CAGGTACTGTGTGCTGTGTAAGG + Intergenic
1124662621 15:31562546-31562568 GTGGCCCTGCATGCTGTGCTGGG + Intronic
1126595706 15:50382654-50382676 CAGGTTCTGCAGGCTGTGGCTGG - Intergenic
1126974801 15:54163696-54163718 TAGGTGCTTTATGCTGTGCTAGG + Intronic
1128328478 15:66740624-66740646 CAGGTGCTGAGTACTGTGCTAGG + Intronic
1128704442 15:69828378-69828400 CAGGTAATGTCTGCTGTGCTGGG - Intergenic
1131898168 15:97056724-97056746 TAGTGAATGCATGCTGTGCTAGG + Intergenic
1131977215 15:97959025-97959047 CAGGTTTTGCATTCTGTACTGGG - Intergenic
1132579592 16:678916-678938 CAGGTACTACCTGCTGTACCTGG - Intronic
1132865106 16:2089429-2089451 CAGGTACAGCGGGCTGTGCCCGG - Exonic
1133284531 16:4684407-4684429 CAGGTACCACACGCTGTGCTGGG + Intronic
1133767446 16:8847931-8847953 CAGGCTCTGCATGCTATGCCAGG + Exonic
1134896881 16:17896175-17896197 ATGGTACAGCATGCTGTGCTGGG + Intergenic
1139370071 16:66461534-66461556 CAGGTTCTGCGTGCTGTGCAGGG + Intronic
1140732584 16:77870152-77870174 CACGTGCTGGGTGCTGTGCTTGG + Intronic
1140938976 16:79703038-79703060 CAGGTACTCAATGAAGTGCTAGG - Intergenic
1141341823 16:83210549-83210571 CACGTACGGCATACTGTTCTAGG + Intronic
1141792097 16:86243820-86243842 CAGCCACTGCCTGCTGGGCTGGG + Intergenic
1141824745 16:86471243-86471265 CCAGTACTGCATGCTGTTCATGG + Intergenic
1143356231 17:6330894-6330916 CAGGTCCAGAATTCTGTGCTGGG - Intergenic
1144516306 17:15919550-15919572 CAGGGACTACAAGCTGTGCCAGG + Intergenic
1144745674 17:17612566-17612588 CAGGTACTGAATGGAGTGCCTGG + Intergenic
1145720605 17:27068349-27068371 CAGGAAGTACATGCTTTGCTGGG + Intergenic
1146611645 17:34310923-34310945 CAGGTACCTCATTCTGTGTTGGG + Intergenic
1148342395 17:46881131-46881153 CAGGCACTCTCTGCTGTGCTTGG - Intronic
1151755426 17:76072790-76072812 CAGGTCCTGCATCCTGGACTGGG + Intronic
1153160493 18:2199398-2199420 CATGTGCTGGATGCTGTTCTGGG - Intergenic
1156507013 18:37603551-37603573 CAGGTACTGGATGCTGTTATTGG + Intergenic
1157107956 18:44792558-44792580 CAGGTACTCCAGGCGGTGGTGGG - Intronic
1159278950 18:66259123-66259145 CAGGTACTATCTGATGTGCTTGG + Intergenic
1160657916 19:282754-282776 GATGTACTGCATGGTGTTCTTGG - Exonic
1161621259 19:5298572-5298594 CGGGTCATGAATGCTGTGCTAGG - Intronic
1162562029 19:11422498-11422520 CAGGTGCTCCAGGCTGTCCTTGG + Exonic
1163129250 19:15262109-15262131 CAGGTACGGGCTGCTATGCTGGG + Intronic
1163511941 19:17740797-17740819 CAGGTACTGGGTCCTGTCCTGGG - Intergenic
1164503796 19:28841485-28841507 CAGGGACTGCATGCTCAGATAGG + Intergenic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
1165603615 19:37079727-37079749 CAGCCACTGGATGCTGTGCGCGG + Intronic
1166663909 19:44665681-44665703 CTGGGCCTGCATGCTGTGCCCGG - Intronic
1167564643 19:50248777-50248799 CAGGTACTACATGACGGGCTCGG - Intronic
926558676 2:14391203-14391225 AGGGTACTTCATGCTGTGGTAGG - Intergenic
927893583 2:26767459-26767481 CACGTGCTGCCTGCTGTGCTGGG + Intronic
931134176 2:59377901-59377923 CACCTACTGCATCCTGTCCTGGG + Intergenic
932099793 2:68888292-68888314 CAGGTTCTGCACTTTGTGCTGGG + Intergenic
935495096 2:103771072-103771094 CAGATACTTAATGCTGTCCTTGG - Intergenic
936551805 2:113449645-113449667 CAGGTACTGCATGCATTCTTTGG + Intronic
937973931 2:127569821-127569843 CAGGAACTGCAGGATGAGCTTGG - Exonic
938766053 2:134461066-134461088 CAGGGCCTGCCTGCTGGGCTGGG - Intronic
941439984 2:165522735-165522757 CATGTTCTGCTAGCTGTGCTTGG + Intronic
945494666 2:210495811-210495833 CAGGTAGTGAATTCTATGCTCGG - Intronic
946689730 2:222301162-222301184 GAGGTACTGCCGGCTGAGCTGGG + Intronic
947257560 2:228182338-228182360 CAGGTTCTGAGTGCTGTCCTCGG - Intergenic
1169689325 20:8312551-8312573 AAGCTACTGCATGCGGTGCTTGG + Intronic
1170492022 20:16886755-16886777 ATGGTACTGCATCCTGCGCTGGG - Intergenic
1171448668 20:25221659-25221681 CAGGCACTCTGTGCTGTGCTGGG + Intronic
1172113642 20:32561536-32561558 CAATTAGTGCCTGCTGTGCTGGG - Intronic
1172772603 20:37390354-37390376 CAGCTGATGCATGTTGTGCTGGG + Intronic
1174038089 20:47680457-47680479 CAGGTCCTGGGTCCTGTGCTGGG - Intronic
1174097724 20:48102610-48102632 CAGGCACTGCATGGGGTGCCAGG - Intergenic
1175610267 20:60345385-60345407 GAGGTGCTGCAGTCTGTGCTGGG + Intergenic
1175862961 20:62159930-62159952 CAGGGACTGCATGTTCTGGTTGG - Exonic
1177151301 21:17457906-17457928 TATTTATTGCATGCTGTGCTGGG - Intergenic
1178170607 21:30035545-30035567 CAGGCATTGCACTCTGTGCTAGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179001429 21:37463401-37463423 CAGGCACTGCACTGTGTGCTTGG + Intronic
1179680378 21:43016435-43016457 GAGGTATTCCAAGCTGTGCTGGG - Intronic
1181495335 22:23284385-23284407 CAGGGGCTGCAGGCAGTGCTGGG + Intronic
1181977769 22:26743315-26743337 GAGGTATTGGATGCTGTGATTGG - Intergenic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1183279993 22:36926919-36926941 GAGGTACTGCAGGCTGTCATTGG + Intronic
1185070004 22:48651013-48651035 CAGGTACTGCATGCCTGGCAAGG - Intronic
1185173585 22:49306919-49306941 CAGGCAGTGCAGGCTGTGCCCGG - Intergenic
951471612 3:23062521-23062543 CAGATCTTGAATGCTGTGCTGGG + Intergenic
952298312 3:32081192-32081214 CAGGTAATGACTGCTGTGATGGG - Intergenic
953148227 3:40299446-40299468 CAAGTCCTCCATGCTGTGCATGG - Intergenic
953239489 3:41136019-41136041 CAGGTGTTGCTTGCTGTGCCAGG - Intergenic
953722566 3:45369106-45369128 CAGGTACTGCATCGAGTCCTCGG + Intergenic
954131919 3:48565205-48565227 CAGGTAGGGCAGGGTGTGCTGGG + Intronic
955027243 3:55180615-55180637 TATATACTGGATGCTGTGCTTGG - Intergenic
955212584 3:56955667-56955689 CAGGATGTGCATGCTGTTCTAGG - Intronic
956304191 3:67805795-67805817 CAGGGACTGCATCCTGCCCTAGG - Intergenic
957118396 3:76057217-76057239 CAGGCACTGCAGGCTGTGGGTGG - Intronic
960253996 3:115490834-115490856 GAGAGACTGCATGCTGTGCTCGG + Intergenic
961209234 3:125112510-125112532 CAGATTCTGCATGAGGTGCTGGG - Intronic
962871127 3:139493992-139494014 CAGGGTCAGGATGCTGTGCTTGG - Intergenic
963528838 3:146447858-146447880 CAGGTTCTGAATGCTGGGATGGG + Intronic
967813128 3:193777179-193777201 CAAATAATGCATTCTGTGCTAGG - Intergenic
968524500 4:1049161-1049183 CAGGAGCTGCTGGCTGTGCTGGG - Intergenic
968973827 4:3810874-3810896 CAGGTACTGGCTTCTGTGCATGG - Intergenic
973062445 4:45744536-45744558 TAGCTAATGCATGCTGGGCTTGG - Intergenic
973321458 4:48814781-48814803 CAAGTCCTGGATGCTGTGTTAGG + Intronic
974060786 4:57033206-57033228 CAGTTACTTCATGCTTTTCTGGG + Exonic
982256056 4:153452640-153452662 CAGGTTCTGTATGCTGTGAGGGG + Intergenic
983293057 4:165831083-165831105 AAGGGACTGCATGATGTGCTGGG - Intergenic
985698935 5:1358880-1358902 CAGCTCCTGCATGGGGTGCTGGG - Intergenic
985950835 5:3220343-3220365 CTGGTGCTGCTTGCTGTTCTGGG + Intergenic
986135653 5:4975176-4975198 CAACTACTGCATGCTGAGCCTGG + Intergenic
987637150 5:20558514-20558536 CAGGTACTGCATGCAGCGAAGGG + Intronic
988502071 5:31791870-31791892 CAGGCACTGAATTCTGTGTTTGG + Intronic
988640144 5:33032810-33032832 CAATTACTGAGTGCTGTGCTGGG - Intergenic
989338533 5:40348436-40348458 CTGGTACTGCACACTGTTCTGGG + Intergenic
990401439 5:55441853-55441875 CATGTACTGCATGCTGTTTGTGG - Exonic
996581726 5:125038703-125038725 CAGTTACTGCATGCTGAGAGGGG - Intergenic
997480502 5:134180796-134180818 CAGCAACTTCATGCTGTTCTAGG - Intronic
998183815 5:139963822-139963844 GAGGTTCTGCATGCTGGGGTGGG - Intronic
999059803 5:148621447-148621469 CAGGTACTGCTAGGTGTGCTAGG - Intronic
999684485 5:154090015-154090037 CAGGCACTGGAGGATGTGCTGGG - Intronic
999777779 5:154824477-154824499 CAGTTAATGCATGCAGTGCCTGG - Intronic
1001435339 5:171695349-171695371 CAGGAACTGCTCCCTGTGCTGGG - Intergenic
1003566798 6:7229388-7229410 CAGGTGCTTTATGCTGTCCTTGG - Exonic
1004056802 6:12147152-12147174 CAGGTAATAGATGCTGTGCAGGG + Intronic
1004241570 6:13927114-13927136 CATGTATTGCATGCACTGCTTGG + Intronic
1004694648 6:18022175-18022197 CAGGTTCTGAATGCTGGGCTTGG - Intergenic
1004955682 6:20725382-20725404 CAGATGCTGCATGCTGTGCAAGG + Intronic
1006280860 6:33051892-33051914 TAGGGAGTGCATGCTCTGCTTGG - Intergenic
1006568539 6:34981019-34981041 TAGATACTGCATGCGTTGCTTGG + Intronic
1006980813 6:38146268-38146290 CTGGTACTACTTGCTGTGGTTGG + Intronic
1007097655 6:39223795-39223817 CCGGTTTTGGATGCTGTGCTTGG - Intronic
1007804729 6:44433187-44433209 CACGTACTGGATACTGTTCTAGG + Intronic
1008701226 6:54102741-54102763 CAGGCACTGCATTAGGTGCTGGG + Intronic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1017866813 6:158451156-158451178 CAGGGACTGAATTCTGTTCTTGG - Intronic
1021946831 7:25735981-25736003 AAGGTAATGCATTTTGTGCTAGG + Intergenic
1023048353 7:36230487-36230509 CAGGGACTGCATGCTGACCATGG - Intronic
1023890011 7:44385247-44385269 CACGCATGGCATGCTGTGCTTGG - Exonic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1026546260 7:71325383-71325405 GATTTACTGCATGCTGGGCTGGG + Intronic
1027833090 7:83205689-83205711 CAGGTAATTCATCCTCTGCTTGG - Intergenic
1028427465 7:90706441-90706463 CAAGTACTGAGTGCTGTCCTAGG + Intronic
1029287621 7:99476860-99476882 CAGGTGCTGTTTTCTGTGCTGGG + Intronic
1031887014 7:127253458-127253480 CGGGTGCTGCCCGCTGTGCTCGG - Intergenic
1032606694 7:133362975-133362997 CAGGTGCTACATGCGGTGCCTGG - Intronic
1034783963 7:153908254-153908276 CTGGTAATGCATGCTGTGAAGGG + Intronic
1035546181 8:483839-483861 CAGGGGCTGCATGCAGAGCTGGG + Intergenic
1036773699 8:11595590-11595612 CAGGAGCTGCCTGCTGAGCTGGG + Intergenic
1037083265 8:14814034-14814056 TAAGTGCTGCATACTGTGCTAGG - Intronic
1037949543 8:23009887-23009909 CAGGCTCTCCAGGCTGTGCTGGG - Intronic
1038975286 8:32688557-32688579 CACGTACTGCATGAGGGGCTGGG - Intronic
1039893052 8:41697338-41697360 CAGGTGCTGCTGGCTGTGCCAGG - Intronic
1040933921 8:52764038-52764060 CAGGCACTGCAGGAGGTGCTTGG + Intergenic
1043919367 8:85963506-85963528 CAAGTAATGCATGCTATGCCAGG - Intergenic
1046631866 8:116629597-116629619 AAGGGACTGCATTCAGTGCTGGG - Intergenic
1047846957 8:128816675-128816697 CAGGTACTGAAGGCTTTGATGGG - Intergenic
1048773046 8:137916052-137916074 CAGGTACTGTATGCAATACTAGG - Intergenic
1049901196 9:167507-167529 CAGGTACTGCATGCATTCTTTGG - Intronic
1052258808 9:26491192-26491214 CAGGTGATGAATGCTGTGCCAGG + Intergenic
1053539089 9:38955246-38955268 CTGAGACTTCATGCTGTGCTAGG - Intergenic
1053744235 9:41177821-41177843 CAGGTACTGCATGCATTCTTTGG - Intronic
1054349512 9:64007719-64007741 CAGGTACTGCATGCATTCTTTGG - Intergenic
1054483035 9:65687377-65687399 CAGGTACTGCATGCATTCTTTGG + Intronic
1054627052 9:67408673-67408695 CTGAGACTTCATGCTGTGCTAGG + Intergenic
1054684109 9:68253432-68253454 CAGGTACTGCATGCATTCTTTGG + Intronic
1054966877 9:71038845-71038867 CAGGTACTGTTTCCTCTGCTTGG - Intronic
1055268082 9:74521750-74521772 CAGGTACTGTATTCAGTGATAGG - Intronic
1055421277 9:76145611-76145633 CTGGTGCTGCAGTCTGTGCTAGG - Intronic
1056212903 9:84381672-84381694 CAGGTACTGCGTTAGGTGCTAGG - Intergenic
1056395751 9:86179858-86179880 CAGGTGCTGCAGGCTCTCCTAGG - Intergenic
1056771505 9:89481091-89481113 CAGGCACTGCATGCTCTCCGAGG + Intronic
1058457854 9:105154944-105154966 CAGGGACTGCACTCTGTGCTGGG - Intergenic
1059382951 9:113942577-113942599 CACCTACTGCATGCAGTGCCTGG - Intronic
1060172992 9:121476889-121476911 CAGGGGCTGCAGGCTGAGCTGGG + Intergenic
1060908744 9:127331692-127331714 CAGCTACTGCTTGCTTGGCTTGG + Intronic
1061801120 9:133113927-133113949 CAGGACCTGGGTGCTGTGCTGGG - Intronic
1062281204 9:135752548-135752570 CATGTCCTGGACGCTGTGCTAGG - Intronic
1185922322 X:4107514-4107536 CATATATTACATGCTGTGCTGGG - Intergenic
1185931990 X:4213600-4213622 CAAGCACTGCATCCTGTACTAGG - Intergenic
1187362880 X:18644484-18644506 CCTGTACTGCACGCTGTACTTGG + Exonic
1187570808 X:20499382-20499404 CATGAACTGAATGCTCTGCTTGG - Intergenic
1188559233 X:31449200-31449222 CAGGCACTGCACGCTATGCCAGG - Intronic
1188808729 X:34624807-34624829 CAGCTACTGAATGATGTCCTGGG - Intergenic
1189588810 X:42490042-42490064 CAAGTACCGCATGCAGTGCCTGG + Intergenic
1190480952 X:50876261-50876283 GAGGTACTCCACTCTGTGCTTGG - Intergenic
1191225956 X:58043479-58043501 CAGGTTCTCAATGCTGGGCTGGG - Intergenic
1191672244 X:63759011-63759033 CAGGTCCTGCCTTCTGTGGTTGG - Intronic
1192319315 X:70076885-70076907 CAGGCACTGCTTGCTGGGTTGGG + Intergenic
1193580385 X:83257254-83257276 CAAGTCCTGATTGCTGTGCTGGG - Intergenic
1197330199 X:125144705-125144727 CAGGTGCCACATCCTGTGCTGGG - Intergenic
1199773568 X:150991164-150991186 CAGGGACCGCTTGCTGTTCTTGG + Intergenic
1199858064 X:151776642-151776664 CAGCTCCTGCCTGCTGAGCTTGG + Intergenic
1199941979 X:152636638-152636660 CAGGTAAGTCATGCTTTGCTGGG + Intergenic
1200216168 X:154369147-154369169 CAGGTGCTGCCTGCTGGGCTGGG - Intronic