ID: 1024228212

View in Genome Browser
Species Human (GRCh38)
Location 7:47344566-47344588
Sequence CCGTGAAATCCACTGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024228212_1024228220 22 Left 1024228212 7:47344566-47344588 CCACCACACAGTGGATTTCACGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1024228220 7:47344611-47344633 GCAAGATCCATCCTCATCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024228212 Original CRISPR CCGTGAAATCCACTGTGTGG TGG (reversed) Intronic
900523000 1:3115212-3115234 TCATGAACTCCAATGTGTGGGGG - Intronic
902278184 1:15354583-15354605 CCGTGAAATACACTATGGGTAGG + Intronic
902854077 1:19187227-19187249 CCGTTGAATCCTCTGTATGGAGG + Exonic
904133963 1:28296759-28296781 CCTTGGACTCCTCTGTGTGGGGG + Intergenic
905794107 1:40805784-40805806 GTGTGAAATCCACTGAGTTGTGG - Intronic
907920195 1:58904311-58904333 ACGGGACATCCTCTGTGTGGGGG + Intergenic
917320108 1:173771973-173771995 CCTTGAAAACCAGAGTGTGGAGG + Intronic
921832240 1:219741205-219741227 TTGTGAAATGCACGGTGTGGTGG - Intronic
924045686 1:240027180-240027202 CCGTGAAATCCACTGAGGTCAGG + Intronic
1065926397 10:30437081-30437103 CCGTGAAATCTAGAGTGAGGGGG - Intronic
1065999125 10:31087750-31087772 CTGTGAAATCCTCAGTGTGTGGG - Intergenic
1067297125 10:44981092-44981114 CCATGAAATCCACATTGTGCAGG + Intronic
1069590217 10:69636822-69636844 CCATGAGATCAGCTGTGTGGGGG + Intergenic
1073952794 10:108830035-108830057 CAGTGAAGTCCACTCTGAGGAGG - Intergenic
1074085089 10:110203833-110203855 CAGTGAACTCCACTGTAGGGCGG + Intergenic
1074387590 10:113028966-113028988 CTGTGAAATCCCCTGTGTAGTGG + Intronic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1076335649 10:129704729-129704751 CCGTGAAAAACAGTGTATGGGGG + Intronic
1076336615 10:129710706-129710728 CAGTGAAATCAACAGTGAGGGGG + Intronic
1077419473 11:2443922-2443944 CCGTGGATTCCCCTGGGTGGGGG - Intergenic
1078326763 11:10387573-10387595 CCGTGAGATGCTCTGTGTGGCGG - Intronic
1079116018 11:17641070-17641092 CTGTGACATCCACTGTGAGGCGG + Exonic
1084997553 11:72996818-72996840 CCTTTAAGTCCAGTGTGTGGTGG - Intronic
1091637068 12:2205232-2205254 CTGGGAAAGCCAGTGTGTGGAGG + Intronic
1093512137 12:19942010-19942032 CTGTGCACTCAACTGTGTGGTGG + Intergenic
1095296982 12:40537713-40537735 CAGGTGAATCCACTGTGTGGCGG + Intronic
1106780758 13:33056972-33056994 CAGTGGAATCCACTCTGAGGAGG - Intronic
1118361740 14:65062900-65062922 CCATGAAGTGCAGTGTGTGGAGG - Intronic
1119147898 14:72333108-72333130 CCCTGAAACCCACAGTGGGGTGG - Intronic
1120174271 14:81276929-81276951 CCTTCAACTCCATTGTGTGGAGG - Exonic
1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG + Intergenic
1124601511 15:31136358-31136380 CTGTGACATCCACCTTGTGGTGG - Intronic
1129764192 15:78150747-78150769 CCATGAAAACCACTGTCTGTTGG - Intronic
1134838536 16:17382492-17382514 CTGTGCAATCCACTCTGTGTGGG - Intronic
1138220145 16:55243272-55243294 CAGAGAAAGCCACTCTGTGGAGG + Intergenic
1138576020 16:57907839-57907861 CCCTGAGAGCCACTGTGAGGTGG - Intronic
1138905789 16:61331011-61331033 CAGTGAAATCCAGTGTGTATAGG - Intergenic
1141804622 16:86334633-86334655 CAGTGAAGGCCACTGTGAGGAGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1147242316 17:39098667-39098689 CCGTGAATTCCACTGCATGGCGG + Intronic
1147333502 17:39712933-39712955 CCGAAAAAACCACTCTGTGGTGG + Intronic
1152178020 17:78800578-78800600 CCATGGAAGCCACTGTGTGGGGG - Intronic
1168385887 19:55962893-55962915 CTGTGTAATCCAGGGTGTGGTGG + Intronic
928584554 2:32745553-32745575 CTGTGATGTCCACTGTGGGGTGG + Intronic
929248617 2:39729307-39729329 CCATGGAATCCACTTTCTGGGGG - Intergenic
931313476 2:61104527-61104549 ACCTTAAATCCAATGTGTGGTGG + Intronic
941033524 2:160540279-160540301 CCCTTAAATCCACAGTGAGGGGG + Intergenic
942359492 2:175157208-175157230 CTCTGAAATCCACTTTGTGCAGG + Intronic
942827709 2:180200092-180200114 CAGTGAAATCCATTGTGCTGAGG + Intergenic
943491499 2:188560380-188560402 CAGTGAAGTCCAATGTGAGGAGG - Intronic
944398433 2:199296924-199296946 CCCAGAAATCCTCAGTGTGGGGG + Intronic
1170950572 20:20932261-20932283 ACGGGAAAACCACAGTGTGGGGG + Intergenic
1171442940 20:25180179-25180201 CTCTGATATCCACTCTGTGGAGG - Intergenic
1171727416 20:28637844-28637866 GCCAGAAATCCACTGTTTGGAGG + Intergenic
1177057849 21:16331135-16331157 CGGTGAAATATACTCTGTGGGGG - Intergenic
1180391754 22:12290263-12290285 GCCAGAAATCCACTGTTTGGAGG + Intergenic
1180407990 22:12574493-12574515 GCCAGAAATCCACTGTTTGGAGG - Intergenic
1180787663 22:18556035-18556057 CTGTGAAAGCCTCTGTCTGGAGG - Intergenic
1181234076 22:21439271-21439293 CTGTGAAAGCCTCTGTCTGGAGG + Intronic
1181244571 22:21495560-21495582 CTGTGAAAGCCTCTGTCTGGAGG - Intergenic
1183068170 22:35378018-35378040 CCCAGCAACCCACTGTGTGGGGG + Intergenic
951998641 3:28759307-28759329 CCCTGAAATCCCAGGTGTGGTGG - Intergenic
962005628 3:131346635-131346657 CCATGAAATTAACTGTGAGGAGG + Intronic
962080545 3:132134935-132134957 CTATGAAATAAACTGTGTGGAGG - Intronic
969012281 4:4075854-4075876 CCCTGATATCCACTGTGAGGAGG - Intergenic
969640301 4:8394302-8394324 CCATGAAATCCACTGAGGGGCGG + Intronic
979464528 4:121021539-121021561 TCTTGAAATCCAATGTGTTGTGG - Intergenic
981809350 4:148755984-148756006 CAGGGAATTACACTGTGTGGGGG - Intergenic
984157649 4:176211165-176211187 CTGTGAAATCCAATTTCTGGTGG - Intergenic
985150583 4:186943323-186943345 CCCTGCAATTCACTGTGTGCTGG - Intergenic
1001714878 5:173807183-173807205 CCGGCAAATCCAGTGTCTGGGGG - Intergenic
1001997399 5:176173526-176173548 CCGGGAAATCCACTGGCTGGCGG + Intergenic
1002812276 6:641938-641960 CTATGAAATCCACTGTTTTGTGG + Intronic
1003245281 6:4377680-4377702 ACATGAAATCTGCTGTGTGGAGG - Intergenic
1006734042 6:36259471-36259493 CAGTGAAAACCATTGTGTGGTGG - Intronic
1007856711 6:44865185-44865207 CAGTGAAATCCACGCTGAGGTGG - Intronic
1022028568 7:26470641-26470663 CAGTGAGATCCTCTGTGGGGTGG + Intergenic
1022821452 7:33965683-33965705 TCGTGTAACCCACAGTGTGGAGG + Intronic
1024228212 7:47344566-47344588 CCGTGAAATCCACTGTGTGGTGG - Intronic
1032332364 7:130992224-130992246 CCCTGACACCCACGGTGTGGAGG - Intergenic
1032409937 7:131687520-131687542 CCGTGACATCTTCCGTGTGGTGG + Intergenic
1040606944 8:48943449-48943471 CTGAGAAATCCACTGTTTGTGGG + Intergenic
1041704397 8:60830641-60830663 CCATGAAATCCCCAGTCTGGGGG - Intronic
1053722325 9:40959259-40959281 GCCAGAAATCCACTGTTTGGAGG - Intergenic
1054343644 9:63892739-63892761 GCCAGAAATCCACTGTTTGGAGG + Intergenic
1055595822 9:77863413-77863435 CAGTGAAATCCACGCTGAGGTGG - Intronic
1203452852 Un_GL000219v1:136721-136743 GCCAGAAATCCACTGTTTGGAGG + Intergenic
1190984850 X:55490942-55490964 CAGTGATATCCATTGTGCGGAGG - Intergenic
1191089868 X:56608542-56608564 ACGTGAATTCCATTGTTTGGGGG - Intergenic
1193336721 X:80298421-80298443 ATGTGAAGTCCACTGTGTGCTGG + Intergenic
1194533635 X:95079524-95079546 CAGAGAAATCCCGTGTGTGGTGG + Intergenic
1195717031 X:107827000-107827022 CTGTGAAATCAGCTCTGTGGGGG + Intronic
1199704555 X:150412616-150412638 CCGTGAAATCAAGTTAGTGGGGG - Intronic