ID: 1024230655

View in Genome Browser
Species Human (GRCh38)
Location 7:47360985-47361007
Sequence CGCCCGTAGCAGCTGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024230655 Original CRISPR CGCCCGTAGCAGCTGGACAT TGG (reversed) Intronic
902383013 1:16061430-16061452 CACCTGAAGCAGCTGGGCATGGG - Intronic
923333568 1:232947569-232947591 TGCCAGTAGCAGCTGGGCGTGGG + Intergenic
1063062662 10:2573900-2573922 AGCACATAGCAGCTGGGCATGGG - Intergenic
1084688896 11:70713442-70713464 CCCCCGTAGCAGCAGGGCTTGGG + Intronic
1090365785 11:126204192-126204214 CTCCCGTATCTGCTGCACATTGG + Intronic
1091686488 12:2566411-2566433 CGCCAGTAGCGGCTGGAAAGGGG - Exonic
1093483544 12:19628954-19628976 AGCCGGTAGCAGCAGGACAGAGG - Intronic
1096414679 12:51402898-51402920 CTCCCATAGCATCTGGCCATGGG - Intronic
1097081202 12:56432480-56432502 CGCCCAGAGGAGCTGGTCATGGG + Exonic
1108925603 13:55739596-55739618 CTCCCGCAGCATCTGGACAAAGG + Intergenic
1109184311 13:59250842-59250864 CTCCTGCAGCAGCTGAACATTGG - Intergenic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1129670156 15:77603305-77603327 GGCCCGTAGCGGCAGTACATGGG + Intergenic
1142190416 16:88714758-88714780 CGCCCCATGCAGCTGGCCATGGG - Intronic
1146480931 17:33204318-33204340 CTGACTTAGCAGCTGGACATGGG - Intronic
1147515517 17:41114130-41114152 GGCAAGAAGCAGCTGGACATTGG + Intergenic
1152356080 17:79808138-79808160 CTCCCTGAGCAGCTGGACAGAGG - Intergenic
1155096320 18:22559610-22559632 GACCCGCAGCAGCAGGACATTGG - Intergenic
1157295478 18:46439070-46439092 TGCCCGTAGCAGCTGGACCTGGG + Intronic
1158725679 18:59969578-59969600 CTCCCGGAGCAGCTGGCCCTCGG - Intergenic
1159504380 18:69315873-69315895 CCCCTGTTGCAGCTGGGCATAGG - Intergenic
1161579110 19:5071038-5071060 CGCCTGGAGCGGCTGGCCATCGG + Exonic
927753065 2:25687023-25687045 CGCCCAAAGCTGCAGGACATGGG - Intergenic
934980436 2:98835297-98835319 CGCCCCTGGCAGCTGGACTGAGG + Intronic
1169276558 20:4237045-4237067 GGACCTTAGCAGCTGGACTTGGG + Intronic
1169557948 20:6769021-6769043 CGCCCGGGGCAGCTGGAAGTGGG - Intronic
1175251034 20:57610395-57610417 AGCCAGGAGCAGCTGGACAGTGG + Intronic
1181089558 22:20463380-20463402 GGCCCATAGCAGGTGGACAGAGG + Intronic
1185044424 22:48522137-48522159 CCCACGTAGAAGCTGGAGATGGG + Intronic
969248781 4:5953836-5953858 TGCCCGTTCCAGGTGGACATAGG + Intronic
969481230 4:7448170-7448192 GGCCCGGAGCAGCAGGACAGTGG - Intronic
974542225 4:63251790-63251812 CAACAGTAGCAGCTGGAAATAGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
992649363 5:78842511-78842533 AGACCGAAGAAGCTGGACATGGG + Intronic
999654029 5:153795185-153795207 CACCCATGGCAGCTGGACTTGGG + Intronic
1001774170 5:174316203-174316225 CCCCTGCTGCAGCTGGACATGGG + Intergenic
1003746495 6:9007911-9007933 TGCCCTCAGCAGCTGGACCTCGG - Intergenic
1020720660 7:11740546-11740568 CCCCCTCAGCAGCTGGACACAGG + Intronic
1021992685 7:26152758-26152780 CTCCCGGAGCAGCTGGCCCTCGG - Exonic
1024230655 7:47360985-47361007 CGCCCGTAGCAGCTGGACATTGG - Intronic
1028452829 7:91005071-91005093 GGCCCATAGCAGCAGGACAGAGG + Intronic
1036900485 8:12665859-12665881 CGCCCGGAGAGGGTGGACATCGG + Intergenic
1037889987 8:22618946-22618968 CGCGCGGAGCAGCAGGACAGCGG + Exonic
1039811915 8:41056794-41056816 TGCACGTTGCAGCTGGAAATAGG - Intergenic
1060348748 9:122839051-122839073 CTCCCCTACCAGCTGGAGATGGG + Intergenic
1196430077 X:115615158-115615180 AGCACGTACCACCTGGACATGGG + Intronic