ID: 1024230701

View in Genome Browser
Species Human (GRCh38)
Location 7:47361232-47361254
Sequence GGGCCCAGCCCAAGACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024230697_1024230701 9 Left 1024230697 7:47361200-47361222 CCATGCCAAAAAAAAAAAAAAAA 0: 154
1: 2567
2: 93622
3: 93232
4: 156652
Right 1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG 0: 1
1: 0
2: 1
3: 43
4: 358
1024230698_1024230701 4 Left 1024230698 7:47361205-47361227 CCAAAAAAAAAAAAAAAAAACAA 0: 126
1: 14068
2: 19020
3: 34417
4: 71855
Right 1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG 0: 1
1: 0
2: 1
3: 43
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024230701 Original CRISPR GGGCCCAGCCCAAGACCCCA AGG Intronic
900103775 1:973720-973742 TGGGGCAGCCCCAGACCCCAGGG - Intronic
900168826 1:1256417-1256439 TGGCCCACCCCAAGATCCCAAGG + Intronic
900184929 1:1328531-1328553 CAGCCCAGCCCAAGGCCCCCAGG + Exonic
900291718 1:1926536-1926558 GGCCCCAGCCCCAGGCCCCAGGG + Intronic
900539856 1:3197238-3197260 GGACCCAGGACAAGAGCCCAGGG + Intronic
900565052 1:3328049-3328071 GGCCCCAGCCCGAGTCCCCCAGG - Intronic
900589572 1:3453725-3453747 GTGCCCGGCCCACGACCCCAAGG + Intergenic
901216816 1:7559699-7559721 GGGCTCAGCTCTGGACCCCAAGG - Intronic
902060296 1:13636118-13636140 GGGCCCAGCTCATGATCCCGGGG - Intergenic
902267783 1:15280577-15280599 CGACCCGGCCCAAAACCCCAGGG + Intronic
902334889 1:15749181-15749203 GAGCCCAGCTCCAGCCCCCAGGG + Intergenic
902621043 1:17651346-17651368 GCCTCCAGCCCAAGGCCCCAGGG - Intronic
902789198 1:18753946-18753968 GGACCCAGCACAAGGTCCCAGGG - Intergenic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903224791 1:21888388-21888410 GGGCACAGCCCAAGACAGCTGGG - Intronic
903839090 1:26225525-26225547 GGACTTTGCCCAAGACCCCAGGG - Intergenic
904337637 1:29808559-29808581 GGGCCCAGCCCAGGCCCTGATGG + Intergenic
906074979 1:43045465-43045487 GGCCTTAGCCCAAAACCCCAGGG - Intergenic
906676138 1:47694766-47694788 GGGCCCAGCCCCACTCCCCTGGG + Intergenic
907341604 1:53739328-53739350 GGGCCCCGCCCAGACCCCCAGGG - Intergenic
907488649 1:54794769-54794791 CGGCCCAGCCCCATAGCCCAGGG + Intronic
909489281 1:76208206-76208228 GGGAGCACCCCTAGACCCCAGGG + Intronic
910201943 1:84708787-84708809 GGGCCCAGCCTCAGAACCTAAGG - Intergenic
910345431 1:86231222-86231244 TGGCACAGCCCAAAACCACATGG - Intergenic
912528951 1:110306315-110306337 AGGTCCAGCCCAAGTCACCAGGG - Intergenic
912864793 1:113247509-113247531 GGGCCCAGCTCCTGTCCCCAGGG - Intergenic
914676839 1:149912592-149912614 GAGACCTGTCCAAGACCCCATGG + Intronic
915044440 1:153000261-153000283 GGGTCTAGCCGAAGCCCCCAGGG + Intergenic
915238427 1:154502337-154502359 CGGCCCAGCCCACGCTCCCAGGG + Intronic
915528372 1:156489743-156489765 GGGTCCAGTCCAGGCCCCCAAGG - Intronic
916841830 1:168609050-168609072 GGGACTAGCCCATGGCCCCAGGG + Intergenic
917067918 1:171117168-171117190 GGGCAAAGCCCAACATCCCATGG + Exonic
917191660 1:172424912-172424934 GGGCCCAGCACAAGGCCACAGGG + Intronic
918043616 1:180928036-180928058 AGGCCCAGCCCAACAACCCCGGG + Intronic
920387382 1:205578615-205578637 GGGCCAAGGCCAAGAGCCAAGGG + Intronic
922418547 1:225443739-225443761 GGGCACAGCCCATGGCACCAAGG - Intergenic
922422521 1:225469386-225469408 GGGCCAAGAACAAGACCTCAGGG + Intergenic
922859301 1:228802404-228802426 GGCCTCAGCCCAAGGCCCAAAGG - Intergenic
923944875 1:238873268-238873290 GGAGCCAGCCTAAGTCCCCACGG - Intergenic
924379948 1:243453309-243453331 GGCCCCAGCCCAAGACTGCAGGG + Intronic
1063134129 10:3201663-3201685 AGGCCCAACCCAGGACCCCACGG - Intergenic
1063178053 10:3570101-3570123 CGGCCAAGCCCAGGACCCTAGGG + Intergenic
1063628992 10:7716915-7716937 AGGACCTGCTCAAGACCCCATGG - Intronic
1063662354 10:8043437-8043459 GGCCCCCGCCCTAGTCCCCATGG + Intergenic
1064164504 10:12974639-12974661 GGGCTCAGCCCTCGGCCCCATGG - Intronic
1067039294 10:42940490-42940512 CCCCCCAGCCCAAGACCCCAAGG - Intergenic
1068930146 10:62581402-62581424 GGGCTTAGCTCAAGACCCTAAGG - Intronic
1069867343 10:71511949-71511971 CCGCCCAGCCCAAAACCCCGAGG - Intronic
1070439525 10:76429768-76429790 GGCCCCTGCCCAGGCCCCCATGG - Intronic
1070778453 10:79123860-79123882 GGGCCCAGCCCGTGGCCACACGG + Intronic
1070785577 10:79160383-79160405 GAGCCCAGCACCAGCCCCCACGG + Intronic
1071188942 10:83078316-83078338 GGGCAGAGCCCAAGACCCAGAGG - Intergenic
1072654341 10:97319774-97319796 GGGCGCAGCGCAGGACCCCAGGG - Exonic
1072784746 10:98272044-98272066 GGGCCCAGGGCAAGACTCAAGGG + Intergenic
1073345264 10:102778052-102778074 AGGGCCTGCCCAAGACCTCAGGG - Intronic
1074965688 10:118488995-118489017 GGGCCCCTCCCAAGACACAAGGG - Intergenic
1075816971 10:125271888-125271910 GGGCTCAGCCTAAGAGCCCTTGG + Intergenic
1076160832 10:128243022-128243044 GACCCCAGCCAAGGACCCCAGGG - Intergenic
1076630590 10:131849745-131849767 GGGCCCGGCCCGACACCCCAGGG - Intergenic
1076693770 10:132237213-132237235 GGGCCCAGCCTGTGAGCCCAGGG - Intronic
1076722498 10:132398857-132398879 GGGGCCAGCCCAAGGCAGCAAGG - Intronic
1076793323 10:132787693-132787715 GGGCCCCTCCCAGCACCCCAAGG + Intergenic
1076842542 10:133052876-133052898 GGGCCCAGCCATGAACCCCAGGG + Intergenic
1076874242 10:133208124-133208146 GGGCCCAGCAAAGGACGCCAAGG + Intronic
1077010639 11:377717-377739 GGGCAAAGCTCAAGACCCCTGGG + Intronic
1077064661 11:635754-635776 GCGCCCAGCCGGAGACCCCAGGG + Intergenic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077117446 11:891545-891567 GGGACCAGCTCAGGAGCCCAGGG - Intronic
1077128629 11:957438-957460 GGGCCCTGCCCCACACCCCGGGG - Intronic
1077178837 11:1203322-1203344 CGGCCCAGCCCAAGCCCTCCAGG - Intergenic
1077391319 11:2301897-2301919 CAGCCCAGCCCAAGACACCAGGG - Exonic
1077417652 11:2432370-2432392 GGGCCCAGCCCCTGCCCCCACGG + Intergenic
1077455187 11:2674064-2674086 AGACCTAGCCCAAGCCCCCATGG - Intronic
1079030658 11:16983828-16983850 GGGCCCAGGCCAAGACTAGAAGG + Intronic
1079296947 11:19242106-19242128 GGGCCAAGGCCCAGAGCCCACGG - Intergenic
1080291945 11:30680896-30680918 AGGCACTGCCCAAGACCCAAGGG - Intergenic
1080880065 11:36311409-36311431 GGGCCCAGCCAAAGAAGCAAAGG + Intronic
1081611638 11:44566427-44566449 GGGTCAAGCCCAGGGCCCCAGGG + Intronic
1081709752 11:45209156-45209178 GGGCCCGGCCCCCGGCCCCAGGG - Intronic
1081730864 11:45370858-45370880 GGGCCTATCCCCAGGCCCCATGG + Intergenic
1081758089 11:45558930-45558952 GTGCTAAGCCCCAGACCCCAGGG + Intergenic
1081976722 11:47240065-47240087 GGGCCCAGCCCACCTCCCCTAGG + Exonic
1083286226 11:61660858-61660880 GGGCCCCGGTCCAGACCCCAAGG - Intergenic
1083805315 11:65070105-65070127 GGGCCCTTCGCAGGACCCCACGG - Intronic
1084106869 11:66986119-66986141 GGGTCCAGCCCCAGACCAGATGG + Intergenic
1084591407 11:70092758-70092780 GACCCCAGACCAAGACCCCAGGG + Intronic
1084967001 11:72750213-72750235 GGGCCCGGTCCAGGCCCCCAAGG + Intronic
1085349002 11:75786349-75786371 GGGACCAGGACAAGAACCCAGGG + Intronic
1085606671 11:77906342-77906364 GGGCCCAGAGCCAGAACCCAAGG - Intronic
1085623967 11:78057892-78057914 GGGCACAGGCAAAGACCACAAGG - Intronic
1086407260 11:86509067-86509089 GGGCACACCCCATGGCCCCATGG - Intronic
1086983058 11:93219514-93219536 GGGGCTAGCACTAGACCCCAGGG + Intergenic
1088112445 11:106277851-106277873 GGGCCCAGTCCTAAACCCCAGGG - Intergenic
1088902229 11:114127037-114127059 GGACCCAGCCTTGGACCCCAGGG + Intronic
1089453515 11:118612551-118612573 GGGCCCACCCCAAGACTGCCAGG - Intronic
1089473880 11:118742859-118742881 GGGCCCAAGCCAAAACTCCATGG + Intergenic
1089729328 11:120510979-120511001 GGGACCAGGCCAAGAACACACGG - Intergenic
1090398965 11:126436249-126436271 GAGCCCAGCCCCCGACCCTAGGG + Intronic
1091374996 12:19320-19342 GAGCCCAGCCCATGCCCACAGGG + Intergenic
1091974481 12:4813515-4813537 GGGCTCAGTCCAAGAGGCCAAGG - Intronic
1092225636 12:6746516-6746538 GTGACCTGCCCAAGACCACAAGG + Intergenic
1093541977 12:20298518-20298540 GGGCCTGGCCCAAGTCCCCCAGG - Intergenic
1094838216 12:34332093-34332115 GTGGCCAGCCCAAGACGGCAGGG + Intergenic
1094838618 12:34333789-34333811 GGGGCCAGCCCAAGGCAGCAGGG + Intergenic
1094843976 12:34353456-34353478 GGGCCCAGCCCAATGCAGCAGGG - Intergenic
1094844436 12:34355250-34355272 GGGTCCAGCCCAACACGGCAGGG - Intergenic
1094844710 12:34356380-34356402 GGGGCCAGCCCAAGGCGGCAGGG - Intergenic
1094852356 12:34387970-34387992 GGGGCCAGCCGAAGACAGCAAGG - Intergenic
1094854725 12:34397812-34397834 GGGGCCAGCCCAAGGCAGCAGGG + Intergenic
1095282631 12:40373809-40373831 GGGCCAGGCCCAACAGCCCAGGG - Intergenic
1096233314 12:49909580-49909602 GGGCCCAGCCCTGGGGCCCATGG + Intergenic
1096647159 12:53045160-53045182 GAGCCCAGCCAAAGACCCTAAGG + Intergenic
1099728579 12:86467365-86467387 AGGCACAGACCAAGACACCATGG + Intronic
1100608352 12:96170106-96170128 GGGCCCTGCCCAACACCCTGAGG + Intergenic
1101919457 12:108920435-108920457 GGGACTAGCCCAAGACCACATGG - Intronic
1102252155 12:111394729-111394751 AGGCCCTGCCCAAGTCCCCTTGG + Intergenic
1103624373 12:122206956-122206978 GGACCCAGCCCAGGACCTCCTGG + Exonic
1108378950 13:49838802-49838824 GGGCCCAGCACAGGGGCCCAAGG + Intergenic
1118404943 14:65413249-65413271 CAGCCCAGCCCAAGACCCCGAGG - Intronic
1121097690 14:91229242-91229264 GGGCCCAGCCCAAGGACCACAGG + Intergenic
1121114443 14:91333748-91333770 GGGCCCCACCCTAGACCCTAGGG - Intronic
1121423709 14:93833420-93833442 GGGCCCTGCACAGGCCCCCATGG - Intergenic
1121507143 14:94485973-94485995 GGGCTGAGCCCAGGAGCCCAGGG - Intergenic
1122387849 14:101361165-101361187 AGGCACAGCCCAGGAACCCAAGG - Intergenic
1122389966 14:101373494-101373516 GTGCCCCTCCCATGACCCCAGGG + Intergenic
1122770958 14:104097448-104097470 AGGCCCAGCCCAGGAGCCCCAGG - Intronic
1122820596 14:104342930-104342952 GGTCCAAGCCCAGGACCCCATGG - Intergenic
1122994014 14:105252970-105252992 GGGCTGAGGCCAAGACCCCTGGG - Intronic
1202899215 14_GL000194v1_random:26031-26053 GGGCCCAGCGCAAGAGCTGATGG + Intergenic
1124154035 15:27209605-27209627 GGGCACAGCCCAGCACCCAAGGG - Intronic
1124396991 15:29310633-29310655 GGGCCAAGCCCAGGAGCACAAGG + Intronic
1126850819 15:52795836-52795858 TGAACCAGCCCAAGACCCGAGGG + Intergenic
1128749746 15:70140463-70140485 AGGCCCAGCCCAAGAGCAGAGGG + Intergenic
1128943895 15:71808938-71808960 TGGTCCAGCCTTAGACCCCAAGG - Intronic
1129189798 15:73930593-73930615 GCGCCCAGCCTCAGACCCCTGGG - Intronic
1129206016 15:74037380-74037402 GGCCCCAGCCCTTGACCCCCTGG + Intronic
1129263645 15:74382612-74382634 AGGCCCATCCCAAGGTCCCAGGG + Intergenic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1129333901 15:74841262-74841284 GGGCCCAACCCCAGACTTCACGG + Intronic
1129680607 15:77656550-77656572 AGCCCAAGCCCCAGACCCCAAGG - Intronic
1130540458 15:84817671-84817693 AGGCCCAGCCCAGGCCTCCAGGG - Intronic
1130787302 15:87114537-87114559 GGGCCCAGCCGGAGACCGCCAGG + Intergenic
1130977547 15:88788993-88789015 GGAACCAGGCCAAGGCCCCAGGG + Intergenic
1131118532 15:89808987-89809009 GGTCCCAGACCAAGGCCCCTTGG - Intronic
1131529591 15:93180178-93180200 GGGCCCATCACAAGTCCTCATGG + Intergenic
1132106162 15:99064268-99064290 GGGGCCGGCCAAAGAACCCATGG - Intergenic
1132405826 15:101541449-101541471 GGGCGTGGCCCAAGACCCCAAGG + Intergenic
1132600313 16:770113-770135 TGGCCCAGCCCACGGCACCAGGG - Exonic
1132632964 16:928716-928738 GGGCCCACCCCACACCCCCACGG + Intronic
1132705049 16:1239908-1239930 AGGCCCAGCCCAGCTCCCCATGG - Intergenic
1132723201 16:1327117-1327139 AGGCCCAGCCCTACCCCCCAGGG + Intergenic
1132805559 16:1773565-1773587 GGGCCCGGCCCCAGGCCCCTCGG - Intronic
1133284841 16:4685895-4685917 GGGCCAAGTCCAAGACACCAGGG - Intronic
1133304681 16:4801729-4801751 AGACCCTGCCCAAGCCCCCAGGG + Intronic
1133641583 16:7722344-7722366 GGGTCCAGATCCAGACCCCAAGG - Intergenic
1136035290 16:27534663-27534685 GTGCTCAGCCCAAGAACACAGGG - Intronic
1136402435 16:30025860-30025882 GGGGGCTGCCCAAGAACCCAGGG - Intronic
1137549093 16:49424606-49424628 GGGCCCAGCCCAGGTCGTCAGGG + Intergenic
1139752806 16:69119704-69119726 GGGCCCAACCCAAGACCAAGTGG - Exonic
1140477841 16:75247875-75247897 GTTCTCTGCCCAAGACCCCAGGG + Intronic
1141784041 16:86186658-86186680 GGGCGCAGCCTAATACCCCCTGG - Intergenic
1142146542 16:88495188-88495210 TGGGCCAGCCCAGGACCCCAGGG - Intronic
1142173798 16:88635734-88635756 GGGCCCAGCCCCCTACCCCCAGG + Intergenic
1142968731 17:3597027-3597049 GGGCCGGGCCCGGGACCCCACGG - Exonic
1143104003 17:4519480-4519502 GGCCCTGGCCCAAGACCCCGAGG + Intronic
1143166640 17:4900287-4900309 GGGCCCAGCCCCAGACGGCAGGG + Exonic
1143564798 17:7715061-7715083 TGGCCCAGCCCCAGTCCCCTTGG - Intergenic
1143712853 17:8745869-8745891 GAGTCCAGCCGGAGACCCCAGGG - Intergenic
1143876150 17:9992171-9992193 GGGCCCAGACAAAAGCCCCAGGG + Intronic
1144060645 17:11580951-11580973 GGAGCCAGCCCAAGAGCACATGG + Intergenic
1144290876 17:13825108-13825130 GGACCCAACCCCAAACCCCAGGG + Intergenic
1146062744 17:29615631-29615653 GGGCCCAGCCCAAGAAGGCGGGG + Exonic
1147187994 17:38722893-38722915 GGGCCCAGCCCCAGTCCCACAGG - Intronic
1147198947 17:38786576-38786598 GGGCCCAGCCACATGCCCCAAGG + Intronic
1147377069 17:40028796-40028818 AGGCCAAGCCCCTGACCCCAGGG - Intronic
1148200904 17:45749481-45749503 GGGCACAGACCAAGCCACCATGG - Intergenic
1150003198 17:61454799-61454821 GAGCCCAGCAGAGGACCCCATGG + Intronic
1150281784 17:63933118-63933140 GTTCCCTGCCCAAGACCCCCTGG - Intergenic
1150471639 17:65442513-65442535 TGGCCCAGCAAAAGTCCCCAGGG - Intergenic
1151162217 17:72175367-72175389 GGGCCCAGCCCCAGCCTCAAAGG - Intergenic
1151848468 17:76674703-76674725 GGGCCCAGCCCCAGGCTCCAGGG + Exonic
1152130908 17:78475943-78475965 GGTCCCAGGCCAAGTCTCCAGGG + Intronic
1152253390 17:79223505-79223527 GGGACAAGCCCAAGACCTCCAGG - Intronic
1152461444 17:80444425-80444447 GTGTCAAGCCCAAGTCCCCAGGG + Intergenic
1152640425 17:81447147-81447169 GGGCCCAGCCTGAGCCCACAAGG + Exonic
1152751148 17:82063025-82063047 CGGCCAAGCCCCAGAGCCCAGGG + Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1154038779 18:10833419-10833441 GGGCCCTGCCCCAGAACCCCTGG + Intronic
1155954019 18:31942474-31942496 GGCCACAGCCCCAGACGCCACGG + Intronic
1156054992 18:32991666-32991688 GGGACCAGCCCGAGACAGCATGG - Intronic
1157392039 18:47311079-47311101 GGGCACAGCCCTTGTCCCCAGGG + Intergenic
1159442772 18:68502943-68502965 GTGCCCAGCCCCAGGGCCCACGG + Intergenic
1160141142 18:76324337-76324359 GCGCCAAGCCCAGGACCCCATGG + Intergenic
1160346408 18:78135826-78135848 CCGGCCAGCCCAAGACCCCCAGG + Intergenic
1160425105 18:78773905-78773927 GTGCCCAGCCCCAGCCCCCACGG + Intergenic
1160571293 18:79819251-79819273 GGGTGCAGCCCAGGACACCACGG + Intergenic
1160675712 19:390180-390202 CAGCGCAGGCCAAGACCCCACGG + Intergenic
1160735086 19:658734-658756 GGGCCCCGCCTCACACCCCAGGG + Intronic
1161301283 19:3544278-3544300 AGGCCCAGCCCACCACCCCGTGG + Exonic
1161504259 19:4635688-4635710 ATGCCCAGCCCCCGACCCCAGGG + Intergenic
1161529215 19:4777082-4777104 TGGCTCAGCCCAAGACCAGAGGG + Intergenic
1161619478 19:5290699-5290721 GGGGCCATCCCATGGCCCCAGGG + Intronic
1162806088 19:13138721-13138743 GGGGCCTTCCCAAGACCCCCAGG - Exonic
1163446405 19:17349021-17349043 CGTCCCAGTCCAGGACCCCAGGG + Intergenic
1164692834 19:30223606-30223628 GGGCCCAGGCCCAGCGCCCAGGG + Intergenic
1165463389 19:35958084-35958106 GGGCTCAGCCTCAGAGCCCAGGG - Intergenic
1165812098 19:38617896-38617918 AGGCCCAGCTCAGGCCCCCAGGG - Exonic
1166048323 19:40242614-40242636 GGCCCCAGGCGAGGACCCCATGG - Exonic
1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG + Exonic
1166978807 19:46620873-46620895 CTGCCCACCCCAAGTCCCCAGGG - Exonic
1167274391 19:48527821-48527843 TGGCCAAGCCCAATATCCCATGG + Intergenic
1167705750 19:51079905-51079927 GAGCCCAGCCCAAGAGCGGAAGG - Intronic
1168520910 19:57049852-57049874 GGGCCCAGGCAAAGACAGCATGG + Intergenic
925217775 2:2111834-2111856 GGGCACAGGCCAGGACCCCCAGG - Intronic
927251341 2:20997265-20997287 GAGCCCAGCCCAAGTCCCTGGGG - Intergenic
927382753 2:22498115-22498137 GAGCCCTGCCCAAGACTTCATGG - Intergenic
927812333 2:26187088-26187110 AGCCCCAGCCCAAGACCCTCCGG - Intronic
927844059 2:26462270-26462292 GTGCTGACCCCAAGACCCCAGGG - Intronic
927869693 2:26615688-26615710 GTGCCAAGCCCAAGACCGCCAGG + Intronic
927885790 2:26717736-26717758 GGGCCCTGCCCAGGACCCCCAGG + Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
929913572 2:46114709-46114731 GTGCCCAGCCCCAGAGTCCAAGG + Intronic
932358005 2:71082461-71082483 GGGACCAGCCCAGGACCCATGGG - Intergenic
932416169 2:71575056-71575078 GGCCCCAGCCCAAACCCCTAGGG - Intronic
933764588 2:85698111-85698133 GGCCCCAGCTCCCGACCCCAGGG - Intronic
935388472 2:102525492-102525514 TGGTCCAGACCCAGACCCCATGG - Intronic
935586266 2:104802538-104802560 TGGTCCAGTCCAAGTCCCCAGGG - Intergenic
936524765 2:113235158-113235180 TGCACCACCCCAAGACCCCATGG - Intronic
936738457 2:115475203-115475225 GGGCCAAGTCCAGGGCCCCACGG + Intronic
937224289 2:120359329-120359351 AGGCCCAGCCCCTGCCCCCATGG - Intergenic
937257409 2:120565119-120565141 TGGCCCGACCCAACACCCCAGGG - Intergenic
937766307 2:125664740-125664762 GGTGCCAGACCAAGAACCCACGG - Intergenic
938181240 2:129187083-129187105 GGCACCAGCGCAGGACCCCATGG + Intergenic
938902369 2:135808942-135808964 GGGCAGAGCCCAAGTCACCAGGG - Exonic
942590002 2:177533415-177533437 GGGCCAAGCCCAAGACAAAAGGG + Intronic
943297825 2:186160859-186160881 AGGCCGAGCCCAGGGCCCCACGG + Intergenic
945658799 2:212659204-212659226 GGGCCCAGTCCCAGACCCCTAGG - Intergenic
945725148 2:213465797-213465819 AGGCCCACCCCAACAGCCCATGG - Intronic
946420586 2:219562375-219562397 GGGCCCAGCCCAGCTCCCCGGGG - Intronic
946431661 2:219629722-219629744 GGGCCCAGCCCAGAGCCACAGGG + Intronic
947746670 2:232511532-232511554 GGGGCCAGCCTGAGTCCCCAGGG + Intergenic
947752556 2:232540461-232540483 GGTCCCACCCCACCACCCCAAGG + Intronic
947794782 2:232887428-232887450 TGGCCCTGCCCAAGAGCCCTGGG - Intronic
948107601 2:235427907-235427929 GGGCCCAGCCCAGGGCTCCTGGG + Intergenic
948582767 2:238999169-238999191 GGCCTCACCCCAAGATCCCAAGG + Intergenic
948852071 2:240713384-240713406 GGGCCCAGGCGCAGACCCCATGG + Intergenic
948979206 2:241484362-241484384 GGGCCCAGCCCAGCACCACGTGG - Intronic
949045730 2:241871945-241871967 CGGCCCAGCCCGGCACCCCAGGG + Exonic
1169893113 20:10474634-10474656 AGCCCCAGCCCAGGCCCCCAAGG - Intronic
1170463532 20:16601443-16601465 TGGCCAAGCTGAAGACCCCAAGG - Intergenic
1171122141 20:22577194-22577216 GCGCACAGCCCAAGGCACCAGGG + Intergenic
1172124366 20:32616528-32616550 GGGACCAGCCCCAGGGCCCAGGG - Intergenic
1172145164 20:32752424-32752446 GTGACATGCCCAAGACCCCAGGG - Intergenic
1172229835 20:33329173-33329195 GGGCCCAGGCCAGGCCCCCAAGG + Intergenic
1172240160 20:33407915-33407937 GGGGCCACCCCAGGACCCAAAGG + Intergenic
1172274938 20:33674278-33674300 AGCCCCAGCCCCAGACCCCGCGG - Exonic
1172786714 20:37473423-37473445 GAGCCCATCCCATAACCCCATGG + Intergenic
1173353484 20:42265759-42265781 GGGCCCAGGGCATGACCCTAGGG + Intronic
1173823225 20:46031666-46031688 AGGCCCAGCCCCAGGCCCCGGGG + Intronic
1174157418 20:48524790-48524812 GGGCTCACCCCAAGTCCCCCAGG + Intergenic
1176076068 20:63248758-63248780 GGGGCCCGGCCCAGACCCCAGGG + Intronic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1179894128 21:44351857-44351879 GGAACCTGCACAAGACCCCAGGG + Intronic
1180049204 21:45323766-45323788 GGGCCCTCCCCAAGCCCCCGCGG + Intergenic
1180092156 21:45538709-45538731 AGGCCCAGCCCCTGAGCCCAGGG + Intronic
1180190157 21:46159078-46159100 CGCCCCAGCCAAAGCCCCCAGGG + Intergenic
1181065563 22:20304127-20304149 GGTCCCAGCCCCTGGCCCCAAGG - Intergenic
1181581989 22:23833714-23833736 GGGCAGAGCCCAGGACCACAGGG - Intronic
1182348123 22:29681275-29681297 GTGACCAGCCCAAGCTCCCATGG + Intronic
1183360029 22:37378653-37378675 GGGCCCAGCCCAAGCCATCCTGG - Intronic
1183608921 22:38884149-38884171 GGGGCCCCCTCAAGACCCCAGGG - Intergenic
1183654264 22:39175873-39175895 GGGCACAGGCCATGCCCCCATGG + Intergenic
1185127899 22:49021932-49021954 GGGCCCAGCCAACCTCCCCAAGG - Intergenic
949480898 3:4493207-4493229 GGGCCCAGCCCGGGCGCCCAGGG + Intergenic
950232693 3:11290398-11290420 GGGCTCAGACCAGGAGCCCATGG + Intronic
953914572 3:46910056-46910078 GGGCCCAGCTCAGAGCCCCATGG + Intergenic
954105147 3:48405853-48405875 GGAGGCAGCCCAGGACCCCAGGG + Intronic
958675676 3:97265600-97265622 GGGGCCTTCCCAAGACCCCGAGG + Intronic
959021645 3:101193898-101193920 TTCCACAGCCCAAGACCCCAGGG + Intergenic
959582270 3:107993644-107993666 GTGCCCAGGGCCAGACCCCAGGG + Intergenic
959743842 3:109753459-109753481 GGAACCAGCCCAAGACGCCTGGG - Intergenic
960948178 3:122981272-122981294 GGGCCCAACACAAGCCCCGAGGG - Intronic
961019834 3:123496247-123496269 GGGCACACCCCTTGACCCCAGGG - Intronic
961463707 3:127068882-127068904 GGGCTCAGCCCAGGGTCCCATGG + Intergenic
961464418 3:127072679-127072701 GGGCTGAGCCCAAGACCCCCTGG - Intergenic
961677375 3:128575997-128576019 GGCCCCGGCCCCTGACCCCAAGG - Exonic
961929362 3:130517078-130517100 GGGCCCAGCGCACGTCCCCCAGG - Intergenic
962380758 3:134896823-134896845 AGGCCCTGCCCAAGAGCCCTTGG + Intronic
967602031 3:191401657-191401679 GGCCAAAGCCCAAGAGCCCATGG + Intergenic
968490926 4:890133-890155 TGGCACAGCCCAAGGCCCCAGGG - Intronic
968616339 4:1579285-1579307 GGGCCCAGCCGAGGCCACCAGGG - Intergenic
968872429 4:3248666-3248688 GGGCCCAGCCCCAGGACCCCAGG + Exonic
969441209 4:7217821-7217843 GAGCCCAGCTCAGGTCCCCACGG - Intronic
969445001 4:7239613-7239635 GGGCCCAGCCCCAGCTCCCCAGG - Intronic
969487359 4:7479695-7479717 GGGCCTGTCCCAAGACCTCATGG - Intronic
969676357 4:8616511-8616533 GGGCCTACCCCAGGGCCCCACGG - Intronic
969680598 4:8641298-8641320 GGCCCCGGCCCAGGACACCATGG + Intergenic
973373984 4:49275650-49275672 GGGCCCAGCGCAAGGCCTGATGG - Intergenic
973383428 4:49334589-49334611 GGGCCCAGCGCAAGGCCTGATGG + Intergenic
973386385 4:49516914-49516936 AGGCCCAGCCCAAGGCCTGATGG + Intergenic
973876439 4:55224337-55224359 GTGCCCAGCCCAGGGCCCCTGGG - Intergenic
976264049 4:83173558-83173580 GAGCCCAGCGCAAGACCCCAGGG - Intergenic
978769618 4:112441229-112441251 CGGCCCTGCCCAAGCCCCAAAGG - Exonic
983649608 4:170025870-170025892 GAGCCCAGCGAAAGCCCCCACGG + Intronic
984102217 4:175499739-175499761 GGGACCTGCCCAGGCCCCCAAGG + Intergenic
984901295 4:184589055-184589077 GGGACCAGAGCCAGACCCCAAGG - Intergenic
985035726 4:185838340-185838362 GTGGCCTGCCCAAGCCCCCAGGG - Intronic
985637905 5:1048893-1048915 GGGCCCAGCCAGAAACCCCTAGG - Intergenic
985753944 5:1701969-1701991 CGGCCCAGTCACAGACCCCATGG - Intergenic
985764144 5:1768076-1768098 GGGCCCAGCCAGGGACCCCCGGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993129283 5:83875270-83875292 GGCCTCAGCCCAACACCACAAGG + Intergenic
994215688 5:97134697-97134719 AAGCCCAGCACAAGACCCAAAGG - Intronic
998074696 5:139225979-139226001 CAGCCCACCCCAAGGCCCCAAGG - Intronic
1000363136 5:160466657-160466679 GGGTCCACCCCAAACCCCCAAGG + Intergenic
1001044383 5:168360729-168360751 GGGCCCCTCCCAAGACTGCATGG - Intronic
1001412413 5:171520540-171520562 AGGCCCTGCCCAAGGCCCCATGG - Intergenic
1001415620 5:171543091-171543113 GGCCCCAGCACATGGCCCCAGGG - Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1002103362 5:176868271-176868293 GGGCCCAGCCCTAGACTCACAGG - Exonic
1002303446 5:178270293-178270315 AGCCCCAGCCCAGGACCCCCTGG + Intronic
1003873505 6:10418976-10418998 CGGCCTCGCCCTAGACCCCAGGG - Intronic
1004503587 6:16229787-16229809 GCTCCCAGACCAAGACCCCAGGG - Intergenic
1005412828 6:25568386-25568408 GCGCCCAGCCTAGGACCACATGG + Intronic
1006117747 6:31784325-31784347 GGGCCAAGGCCAAGACCACAAGG - Intronic
1007415461 6:41688864-41688886 GGCCCCAGCCCATGCCACCAAGG - Intronic
1012583178 6:100892886-100892908 GTGCAGAGCCCAAGCCCCCAAGG - Intergenic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1013634067 6:112011832-112011854 AAGCCCAGCCCAAAACACCATGG + Intergenic
1013824684 6:114197014-114197036 GGAGACAGCCCAAGGCCCCAGGG + Intronic
1017004343 6:150019483-150019505 GGGCCCAGACTCAAACCCCACGG + Intronic
1017965246 6:159258580-159258602 GGGGCCAACCCAAGAGCCCCTGG - Intronic
1018894464 6:168004122-168004144 AGGAGCAGCCCAACACCCCAGGG + Intronic
1019160175 6:170064109-170064131 GGTCCCAGTCCAAGAATCCATGG + Intergenic
1019531651 7:1506465-1506487 GGGCCCAGGCCAGAACCTCAGGG + Intergenic
1019618061 7:1975467-1975489 GTGCCCAGCCCAGGCCGCCAGGG - Intronic
1019649468 7:2148888-2148910 AGGCCAACCCCCAGACCCCATGG + Intronic
1019769898 7:2877002-2877024 GGGCCCAGGCCAAGACCAGCCGG - Intergenic
1022102201 7:27175234-27175256 TGGGCCAGCCAAGGACCCCAAGG - Intronic
1022126745 7:27364988-27365010 AGGCCCAGCCAAACACACCAGGG + Intergenic
1022648663 7:32255136-32255158 GGGCCCAGCGCGTGAACCCAGGG + Intronic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1025145436 7:56496907-56496929 GGGCCCAGCCACACACCCCTGGG - Intergenic
1025738353 7:64174616-64174638 GGGCCCAGCCACACACCCCTGGG - Intronic
1025845970 7:65197870-65197892 GGGCCCAGAGCCAGAACCCAAGG + Intergenic
1025896194 7:65703578-65703600 GGGCCCAGAGCCAGAACCCAAGG + Intergenic
1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG + Intergenic
1028998787 7:97130571-97130593 GGGGCCAGCCCAAGAGCCACAGG - Intronic
1029531204 7:101126555-101126577 GGGCCCAGCCCAACAGCCACAGG - Intergenic
1032708985 7:134446428-134446450 GGGGCCTGCCCAAGAGCCCCAGG + Intronic
1032853577 7:135815831-135815853 GTGACCTGCCCAAGACCCTAGGG + Intergenic
1034927155 7:155131470-155131492 TGGCCTGGCCCAAGGCCCCAGGG + Intergenic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1035388110 7:158488268-158488290 TGGCCCAGCCTAGGACCCCCTGG - Intronic
1035602797 8:906661-906683 GGGGCCAGCACCTGACCCCATGG + Intergenic
1036623603 8:10445916-10445938 GGGGCCACCCTAAGACGCCAGGG - Intergenic
1036699701 8:11004132-11004154 TGCCCCAGCCCAAGACTCCCAGG - Intronic
1037396804 8:18451992-18452014 GGGCCCACCTCAAAACTCCAGGG + Intergenic
1037468243 8:19182076-19182098 GGGCCTTTCCCAAGACCCCAGGG - Intergenic
1038426854 8:27469417-27469439 GGGCCCAGCCCCAGAAGACAGGG + Intronic
1038910731 8:31960733-31960755 GGGCTCAGCCCCAGACACCTGGG + Intronic
1044856973 8:96486226-96486248 AGGCACACCCCAACACCCCAAGG - Intergenic
1048305811 8:133283972-133283994 GGGCCCAGCCCTCGATCCTATGG + Intronic
1048324443 8:133428338-133428360 GGGTCCAGATCCAGACCCCAAGG - Intergenic
1049588208 8:143441514-143441536 CGGCCCAGCCTAAGACCCCCAGG - Intronic
1049695815 8:143983829-143983851 GGGTCCAGCCCCTGACCCAATGG - Intronic
1049720840 8:144114833-144114855 GGGCCCAGACCTGGACTCCAAGG + Exonic
1049733396 8:144190830-144190852 GGACCGAGCCCCAGACCCCACGG + Exonic
1049775129 8:144400583-144400605 AGGCCCCGCCCTAAACCCCATGG + Intronic
1050328864 9:4524919-4524941 GGATCCAGCTCATGACCCCAAGG + Intronic
1052995960 9:34551799-34551821 GGGTCCAGCCCAAGGGGCCAGGG + Exonic
1053004174 9:34593308-34593330 GGGTCCAGCCCAGGCCCCTAGGG + Intergenic
1053071361 9:35103982-35104004 GGGACTAGCCTAAGACCTCATGG + Intergenic
1057232978 9:93336043-93336065 GGGGCCAGCCCATGGCGCCAGGG + Intronic
1057252534 9:93515578-93515600 GGGGCCAGCCCATGGCGCCAGGG - Intronic
1057258283 9:93568369-93568391 AGGCCCAGCCCTAGGCCCCATGG + Intergenic
1059450487 9:114368454-114368476 GGGCCCGGCCGAGGACCCCCAGG - Exonic
1060520268 9:124290369-124290391 GGGCCCAGCCTCCGCCCCCAAGG + Intronic
1061312819 9:129775143-129775165 GGACCCAGGTGAAGACCCCAGGG - Intergenic
1061420832 9:130472179-130472201 GGGCCCAGCCCCACACCCCGGGG + Intronic
1061424967 9:130493077-130493099 TGGCCAAGCCCAGGACACCAGGG + Intronic
1061450190 9:130663541-130663563 GGGACCAGCCCCAGCCCCGACGG + Intergenic
1062261310 9:135664577-135664599 GGGCCCAGCCCAAGAACTTGGGG + Intronic
1062532169 9:137006802-137006824 GGGCACAGGCCAAGGCCCCAGGG - Intergenic
1062560769 9:137140922-137140944 TGCCCCAGCCCAGGACACCATGG + Intronic
1186047546 X:5552543-5552565 GGGCCCAGAGCAGGAACCCAGGG - Intergenic
1187041347 X:15599385-15599407 GGGGCATGCCCAAGACCCTAGGG + Intronic
1188568482 X:31553364-31553386 GGGCCCTACCCAAGACTGCATGG - Intronic
1190055604 X:47179525-47179547 GAGCCCAGCCCGACACCCTAGGG - Intronic
1190107678 X:47571456-47571478 AGGCCCCGCCCAAGCCACCAGGG + Exonic
1190533868 X:51407423-51407445 TGGCCCAGACCAAGAGCCCCGGG + Exonic
1191844934 X:65540055-65540077 GGGTCCAGATCCAGACCCCAAGG - Intergenic
1192360633 X:70436609-70436631 GGCTCCAGCCTGAGACCCCAGGG - Intergenic
1194577215 X:95627614-95627636 GGACCCAAACCAAGACCCTAAGG - Intergenic
1194578509 X:95642145-95642167 GGGCCCAACCCAGGAAACCATGG + Intergenic
1199391162 X:147280842-147280864 TGGCCCAGCACAAGACAACATGG - Intergenic
1199391380 X:147283540-147283562 TGGCCCAGCACAAGACAACATGG - Intergenic
1199391598 X:147286239-147286261 TGGCCCAGCACAAGACAACATGG - Intergenic
1199393645 X:147309440-147309462 GGGTCCTGATCAAGACCCCAAGG - Intergenic
1200039631 X:153355815-153355837 GGCCCCAGCCACAGAGCCCATGG + Intronic
1200050260 X:153425629-153425651 GCCCCCAGCCCAACACCTCATGG - Intergenic
1200052921 X:153444369-153444391 GGGGCCAGCACAAGACCTCCAGG - Intergenic
1200071647 X:153532226-153532248 GGGCCCCTCTCAGGACCCCATGG - Intronic