ID: 1024231852

View in Genome Browser
Species Human (GRCh38)
Location 7:47368914-47368936
Sequence CTCAGTGTCCGCCCAGATGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024231852_1024231862 9 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231862 7:47368946-47368968 AGCAGGGGCTGGGGCTGCTTGGG 0: 1
1: 0
2: 8
3: 111
4: 809
1024231852_1024231857 -6 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231857 7:47368931-47368953 ACTGAGGGCTTTCTCAGCAGGGG 0: 1
1: 0
2: 1
3: 23
4: 250
1024231852_1024231860 0 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231860 7:47368937-47368959 GGCTTTCTCAGCAGGGGCTGGGG 0: 1
1: 1
2: 3
3: 48
4: 361
1024231852_1024231855 -8 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231855 7:47368929-47368951 ACACTGAGGGCTTTCTCAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 147
1024231852_1024231861 8 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231861 7:47368945-47368967 CAGCAGGGGCTGGGGCTGCTTGG 0: 2
1: 0
2: 15
3: 143
4: 1044
1024231852_1024231858 -2 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231858 7:47368935-47368957 AGGGCTTTCTCAGCAGGGGCTGG 0: 1
1: 0
2: 2
3: 27
4: 289
1024231852_1024231859 -1 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231859 7:47368936-47368958 GGGCTTTCTCAGCAGGGGCTGGG 0: 1
1: 0
2: 3
3: 29
4: 270
1024231852_1024231856 -7 Left 1024231852 7:47368914-47368936 CCTGCATCTGGGCGGACACTGAG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1024231856 7:47368930-47368952 CACTGAGGGCTTTCTCAGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024231852 Original CRISPR CTCAGTGTCCGCCCAGATGC AGG (reversed) Exonic
900634328 1:3654624-3654646 CTCAGTGTCCTCACACATGATGG + Intronic
900897857 1:5496315-5496337 CTCTGTGTCCCCCCAGCTGGAGG + Intergenic
901022902 1:6264012-6264034 CTCATAGGCAGCCCAGATGCTGG - Intergenic
901470026 1:9449777-9449799 CTCAGTGTCCACCCAGCGCCTGG - Intergenic
907943099 1:59107790-59107812 CCCAGCCTCCGCCCAGATGCTGG + Intergenic
910693904 1:89992444-89992466 TTCAGGGTCCACCCAGTTGCTGG - Intergenic
912383411 1:109259769-109259791 CTCCGCCTCCGCCCAGCTGCTGG + Intronic
912456971 1:109804437-109804459 CTCAGTGGCCACCTAGATACAGG - Intergenic
916168249 1:161982194-161982216 CTCAGGTTCCTCCCACATGCCGG - Intergenic
916498405 1:165365741-165365763 CTTAGTGTCCTCCCAGAGTCAGG + Intergenic
919912936 1:202123044-202123066 CTCTGTGCCTGCCCAGGTGCAGG - Exonic
1067034666 10:42904084-42904106 CTCAGTACCAGCCCAGAGGCTGG + Intergenic
1070521047 10:77253885-77253907 CACATTGTCAGCCCAGATCCAGG + Intronic
1075077731 10:119362265-119362287 GTCAGTGTCATCCCAGGTGCTGG + Intronic
1075728000 10:124620457-124620479 CTCAGTCTCCCCTCAGAGGCAGG + Exonic
1076167705 10:128295568-128295590 CTCAGTGCCCACCCAGGAGCTGG + Intergenic
1076230923 10:128819479-128819501 CTCGGTGTTCCCCCAGAGGCTGG - Intergenic
1077286132 11:1766833-1766855 CTCAGAATCTGCCCAGCTGCTGG + Intergenic
1077286142 11:1766872-1766894 CTCAGAATCCGCCCAGCTGTTGG + Intergenic
1077413898 11:2415627-2415649 CTCTGTGCCCGCCCCAATGCAGG - Intronic
1080650638 11:34220169-34220191 CATAGTGTCCTCCAAGATGCTGG - Intronic
1081738504 11:45421878-45421900 CTGAGTCTCAGCTCAGATGCTGG - Intergenic
1082783674 11:57304753-57304775 CTCAGTCTCCCCCAAGAAGCTGG - Intronic
1084238099 11:67801004-67801026 GGCAGTGTCCGCCCAGTAGCTGG - Intergenic
1084834314 11:71791830-71791852 GGCAGTGTCCGCCCAGTAGCAGG + Intronic
1084977998 11:72813970-72813992 CTCAGTGTACGCGCAGAGCCCGG + Intergenic
1089576437 11:119447690-119447712 CTCTGGGTCCTCCCACATGCTGG + Intergenic
1089645429 11:119875713-119875735 CACAGTGACAGCCCAGAGGCGGG - Intergenic
1092408769 12:8238634-8238656 GGCAGTGTCCGCCCAGTAGCCGG - Intergenic
1098151908 12:67555793-67555815 CTCAGTGTCTGCCCATATGGCGG + Intergenic
1105378748 13:19866862-19866884 CTCACTCTGCACCCAGATGCTGG - Intergenic
1106423515 13:29603724-29603746 CTCACTGTCGGCCCATCTGCAGG - Intergenic
1106883460 13:34157157-34157179 CTCCGTGTGCGAGCAGATGCCGG - Intergenic
1110288165 13:73773828-73773850 CTCAGTGTCTGTGCATATGCTGG + Intronic
1113765097 13:112876409-112876431 CCGAGTGTCCCCCCAGGTGCAGG + Intronic
1113782892 13:112986705-112986727 CCCAGTGTCCACCCACAGGCAGG - Intronic
1116044805 14:39731761-39731783 CTTAGTATCAGCCCAGAAGCTGG - Intergenic
1117071797 14:52064203-52064225 CTCAGTCTCCACCCAGATGGAGG + Intronic
1118887816 14:69880927-69880949 CTTAATGACTGCCCAGATGCTGG + Intronic
1121020734 14:90578619-90578641 CTCAGTGTCTGGACAGAGGCTGG + Intronic
1121249632 14:92489912-92489934 GTCAGTGTCCGGTAAGATGCGGG - Intronic
1124629570 15:31328617-31328639 CTCAGCGCCCGCCCTGGTGCAGG - Intronic
1128984121 15:72206874-72206896 CTCTGTCCCCTCCCAGATGCTGG - Exonic
1129689312 15:77704456-77704478 CTCAGTGTCTGACCAGAGTCGGG - Intronic
1129871341 15:78943898-78943920 CTCAGTGGGCGCCCAGCTCCAGG - Intronic
1130730374 15:86486006-86486028 CTAAGTGTCAACCCAGATACAGG - Intronic
1132744557 16:1431292-1431314 CTCACGGACAGCCCAGATGCAGG - Intergenic
1132915156 16:2340212-2340234 CTCTGTGTGCGCCCAGAAGGTGG - Intronic
1132976088 16:2711867-2711889 CTCAGTCTCCACCCCCATGCAGG - Intergenic
1133268584 16:4599567-4599589 CCCAGCGTCCACCCAGCTGCAGG + Intronic
1133349737 16:5093451-5093473 GGCAGTGTCCGCCCAGTAGCCGG - Intronic
1139859541 16:70009891-70009913 ACCAGTGGCCGCCCAGAGGCGGG - Intergenic
1140663900 16:77212114-77212136 CTCTTTGTCCTCGCAGATGCTGG + Exonic
1140756452 16:78071831-78071853 CTCATTGTCTTCGCAGATGCAGG + Intergenic
1140776646 16:78254907-78254929 CCCACTGTCTGCCCAGAGGCTGG + Intronic
1141634755 16:85308305-85308327 CTCAGCGTCCTCCCGGAGGCTGG - Intergenic
1141876369 16:86827627-86827649 CTCAGTGTCCACCGCGTTGCAGG + Intergenic
1143362594 17:6383897-6383919 CCCAGTGTGAGCCCAGATTCTGG - Intergenic
1144708746 17:17386743-17386765 CACAGTGCCCGCCCAGATCTTGG + Intergenic
1151498631 17:74474646-74474668 CTCAGTTTCCTCCTGGATGCTGG - Exonic
1152322220 17:79614101-79614123 CTGAGTCTCGGCCCAGAGGCAGG + Intergenic
1156298844 18:35817943-35817965 CTCAGCTTCCCCCCAGATTCTGG + Intergenic
1156365179 18:36419619-36419641 CCCAGTGTCAGCACAGATGCAGG - Intronic
1158830599 18:61273603-61273625 CTTCATTTCCGCCCAGATGCTGG - Intergenic
1160380565 18:78451569-78451591 CTCACTGTCCCCACGGATGCTGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162301991 19:9849517-9849539 CCCCGTGTCCCCCCAGGTGCTGG + Exonic
1162959739 19:14118476-14118498 CTCAGTGTCCACCCCTTTGCTGG + Intergenic
1163641769 19:18466196-18466218 CTCAGCACCTGCCCAGATGCAGG + Intronic
1164670667 19:30070379-30070401 CTCAGTGCCAGCCCAGCTGGAGG + Intergenic
1166130939 19:40745111-40745133 CTCAGTATGTGCCCTGATGCGGG - Exonic
925731249 2:6920586-6920608 CTCAGAGGCAGCCCAGAGGCGGG + Intronic
927073082 2:19549732-19549754 CTGAGTGTCACCCAAGATGCAGG - Intergenic
928172098 2:29010506-29010528 CTCAGTGCCTGCCTGGATGCAGG - Intronic
932158227 2:69437489-69437511 CCCAGTGCCCGCCCAGCTACCGG - Exonic
934502750 2:94872607-94872629 CTCAGTCCTGGCCCAGATGCTGG + Intronic
935894400 2:107719286-107719308 TTCAGTGGCCTGCCAGATGCAGG - Intergenic
937318080 2:120944633-120944655 CTAATGGTCCACCCAGATGCAGG - Intronic
938192639 2:129297555-129297577 CTCAGAGTCATCCCAAATGCAGG + Intergenic
948019238 2:234716429-234716451 CACAGTGGCCCCCCAGGTGCTGG + Intergenic
1172130382 20:32650973-32650995 CCCAGTGTCAGCCCAGGTGTGGG + Intergenic
1175923717 20:62462008-62462030 CGCAGTGTCCACCCAGCAGCAGG + Intergenic
1175937978 20:62523716-62523738 CTCCGTGTCAGCCCGGCTGCAGG + Intergenic
1179618993 21:42600086-42600108 CACAGGGTCCGACCAGCTGCAGG + Intergenic
1183810452 22:40252693-40252715 CTCAGTTTCAGCCCAGAAGTAGG + Intronic
1184340782 22:43884834-43884856 CTCTGTCCCAGCCCAGATGCTGG - Intronic
1185182247 22:49370082-49370104 CCCAGGGTCTTCCCAGATGCTGG - Intergenic
1185210420 22:49567739-49567761 CTCAGTGTCCAACCAGCTGCAGG - Intronic
1185347302 22:50316202-50316224 TTCAGGGTCTGCCCAGGTGCAGG + Exonic
950298445 3:11852389-11852411 CTCAGTGTCCCCCTAGAAGGAGG - Intergenic
951808865 3:26677558-26677580 CCCAGTGTCCGCCAACAAGCTGG - Intronic
954716762 3:52530855-52530877 CCCAGTGTCCCTCCAGAAGCAGG + Intronic
957054038 3:75430799-75430821 GGCAGTGTCCGCCCAGTAGCCGG - Intergenic
961887707 3:130107176-130107198 GGCAGTGTCCGCCCAGTAGCTGG - Intronic
962677955 3:137770284-137770306 CTCTGTGTGCGCCCAGGTTCCGG + Intergenic
963755747 3:149233489-149233511 CCCAGTGTCTGCATAGATGCTGG + Intergenic
967352038 3:188524732-188524754 CTCAAGGTCAGCCAAGATGCTGG - Exonic
968872605 4:3249350-3249372 CTCGGCGTCCGTCCAGTTGCGGG - Exonic
969077733 4:4593536-4593558 CTCAGTGACCACCAAGATCCCGG - Intergenic
969352899 4:6608376-6608398 CTCATTGTCCGCCCACAGCCAGG + Intronic
972219286 4:36935690-36935712 CTCAGTGTCTGCCCAATTGGTGG - Intergenic
976655959 4:87489160-87489182 CTCGGTGTCTGCCCAAATGGTGG + Intronic
980244642 4:130223749-130223771 CTCAGTGTCACCTCAGATCCTGG + Intergenic
985645037 5:1080769-1080791 CTCAGTGTGAGCTCAGAGGCCGG - Intronic
988540282 5:32102292-32102314 CTCAGTGCCCACCCAGGAGCAGG + Intronic
991313552 5:65273365-65273387 CACAGTGTCCCCTCAGCTGCTGG + Exonic
996694855 5:126382992-126383014 CTCAGTATCGGCCCAGAGCCTGG - Intronic
1000147866 5:158470924-158470946 CTCACTGTCCTACCTGATGCGGG - Intergenic
1002076636 5:176712364-176712386 CTCACTGTCTTCCCAGCTGCAGG + Intergenic
1007105910 6:39282703-39282725 CTCAGGGTTTGCCCAGATTCTGG - Intergenic
1010276303 6:73972176-73972198 CTCAGTGTCTGCCCAAATGGCGG - Intergenic
1011624620 6:89272885-89272907 CTCAGCTCCCGCCCAAATGCAGG + Intronic
1023865820 7:44237898-44237920 CCCAGTGTCCGGCCAGCTGCAGG - Intronic
1024231852 7:47368914-47368936 CTCAGTGTCCGCCCAGATGCAGG - Exonic
1025178241 7:56812561-56812583 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025178673 7:56814303-56814325 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025179111 7:56816093-56816115 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025179566 7:56817979-56818001 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025180016 7:56819817-56819839 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025181361 7:56825388-56825410 CTCAGTGCCTGCCCAGCTCCTGG - Intronic
1025181808 7:56827226-56827248 CTCAGTGCCTGCCCAGCTCCTGG - Intergenic
1025691006 7:63753415-63753437 CTCAGTGCCTGCCCAGCTCCTGG + Intergenic
1027121919 7:75527986-75528008 CTCCGCGTCCGCCTAGGTGCTGG + Intergenic
1028957406 7:96709519-96709541 CTCAGTGGCGCCCCAGATTCGGG - Intronic
1033207190 7:139433273-139433295 CTCAGACTCCTCCCAGGTGCAGG - Intergenic
1035241296 7:157531409-157531431 GTCAGTGTCCACCAACATGCTGG - Intergenic
1036380398 8:8232885-8232907 GGCAGTGTCCGCCCAGTAGCTGG + Intergenic
1036849163 8:12189775-12189797 GGCAGTGTCCGCCCAGTAGCTGG - Intronic
1036870524 8:12432049-12432071 GGCAGTGTCCGCCCAGTAGCTGG - Intronic
1040565792 8:48565569-48565591 GTGAGTGGCCGCACAGATGCAGG + Intergenic
1041714767 8:60923158-60923180 CTCAGCGTACGCCCAGGTCCTGG - Intergenic
1043876358 8:85491255-85491277 CTCAGTGCCAGCCCAGAACCAGG - Intergenic
1050545212 9:6703899-6703921 CTTAGGGACCGCCCAGAGGCTGG + Intergenic
1051533068 9:18127008-18127030 CTGTGTGTCCGTCAAGATGCTGG + Intergenic
1056001723 9:82224685-82224707 CTCTGTGTCCACACAGAAGCAGG + Intergenic
1056176818 9:84044137-84044159 CTCAGTGTTTGCCCAAATGGCGG + Intergenic
1057393117 9:94655646-94655668 CACAGTGTCCACCCAGAATCTGG + Intergenic
1060700655 9:125747072-125747094 CTCAGCGCCCGCCGAGTTGCCGG - Intergenic
1190680177 X:52820064-52820086 CTCAGTGACAGCACAGATGGTGG + Intergenic
1190999917 X:55648665-55648687 CTCAGTGACAGCACAGATGGTGG - Intergenic
1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG + Intergenic
1200978920 Y:9243464-9243486 CTCAGGGTCCTCCCAGAATCTGG - Intergenic
1201422723 Y:13818012-13818034 CTCAGTGGCCCCTCAAATGCAGG - Intergenic
1202183550 Y:22159751-22159773 CTCACTGATCGCCCAGCTGCAGG - Intergenic
1202207809 Y:22426650-22426672 CTCACTGATCGCCCAGCTGCAGG + Intergenic