ID: 1024233231

View in Genome Browser
Species Human (GRCh38)
Location 7:47378658-47378680
Sequence ATCCATACCCCTTCTGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024233231_1024233242 17 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233242 7:47378698-47378720 ACAAGGTTAGGGGGATTGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 110
1024233231_1024233234 0 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233234 7:47378681-47378703 TCTCCTCTGCTTAACCCACAAGG 0: 1
1: 0
2: 2
3: 34
4: 176
1024233231_1024233239 8 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233239 7:47378689-47378711 GCTTAACCCACAAGGTTAGGGGG No data
1024233231_1024233236 5 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233236 7:47378686-47378708 TCTGCTTAACCCACAAGGTTAGG No data
1024233231_1024233237 6 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233237 7:47378687-47378709 CTGCTTAACCCACAAGGTTAGGG No data
1024233231_1024233238 7 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233238 7:47378688-47378710 TGCTTAACCCACAAGGTTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1024233231_1024233243 18 Left 1024233231 7:47378658-47378680 CCAAACCCAGAAGGGGTATGGAT 0: 1
1: 0
2: 1
3: 9
4: 162
Right 1024233243 7:47378699-47378721 CAAGGTTAGGGGGATTGCAAGGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024233231 Original CRISPR ATCCATACCCCTTCTGGGTT TGG (reversed) Intronic
902238252 1:15071543-15071565 ATCCATACCCAGGCTGGGTGCGG - Intronic
902954962 1:19919248-19919270 ATCCACACCCCTTCTTTGATGGG - Intergenic
903082213 1:20820025-20820047 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
905300497 1:36983399-36983421 ATGCATACCCCTTCTGGCACCGG + Intronic
907505984 1:54918587-54918609 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
907602867 1:55787976-55787998 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
908455818 1:64303827-64303849 ATCAATACACCTTCTGTGTGAGG + Intergenic
910520351 1:88114464-88114486 ATCCATATTCCTTCCTGGTTAGG + Intergenic
913544533 1:119853911-119853933 ACCCATACCCCTCCTGTGTGTGG + Intergenic
913602276 1:120433467-120433489 ACCCATACCCCTCCTGTGTGTGG - Intergenic
914084774 1:144443170-144443192 ACCCATACCCCTCCTGTGTGTGG + Intronic
914190782 1:145408336-145408358 ACCCATACCCCTCCTGTGTGTGG + Intergenic
914363448 1:146957073-146957095 ACCCATACCCCTCCTGTGTGTGG - Intronic
914488229 1:148130061-148130083 ACCCATACCCCTCCTGTGTGTGG + Intronic
914588591 1:149085181-149085203 ACCCATACCCCTCCTGTGTGTGG + Intronic
920279261 1:204830400-204830422 ATCTATCCTCCTTCTGGTTTGGG + Intronic
920425995 1:205875598-205875620 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
924672892 1:246147526-246147548 AGCCTCACCCATTCTGGGTTGGG + Intronic
1067985164 10:51135877-51135899 GTCCATGCCACTTCTAGGTTAGG - Intronic
1068060792 10:52064736-52064758 ACCCCCACCCCTTCTGAGTTGGG - Intronic
1070801426 10:79246562-79246584 ATCCTTCTCCCTGCTGGGTTCGG - Intronic
1071300509 10:84252927-84252949 AGCTCTGCCCCTTCTGGGTTGGG + Exonic
1071327318 10:84530097-84530119 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1075315672 10:121451172-121451194 ATAAATACCCCTTCTGCTTTGGG - Intergenic
1076427728 10:130379528-130379550 TTCCTTCCCACTTCTGGGTTCGG + Intergenic
1078535564 11:12170730-12170752 TTCCATCCCCAATCTGGGTTTGG + Intronic
1079861652 11:25679762-25679784 ATGCATACCCCTTCTGATCTAGG - Intergenic
1080426398 11:32158643-32158665 AACCATACCTCTGCTGGGCTAGG - Intergenic
1081070257 11:38602543-38602565 ATGCCCAACCCTTCTGGGTTGGG + Intergenic
1081741237 11:45442278-45442300 ATTCATACCCCTTCTGAACTGGG - Intergenic
1084052001 11:66606039-66606061 CTCCATGCCCCTTATGGGCTTGG + Intergenic
1084149120 11:67279943-67279965 AGCCATACCCCTTCTGAGAGCGG - Intronic
1084991012 11:72925804-72925826 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
1086543481 11:87940925-87940947 ATGTATAACCCTTCTGGGCTGGG - Intergenic
1087022208 11:93614995-93615017 ATCTAAACCACTTCTGGTTTGGG + Intergenic
1087465186 11:98495254-98495276 GTCCTTTCCCCTTCTGGGTAGGG + Intergenic
1087912264 11:103767813-103767835 TTCCATACTCCCTCTGTGTTGGG - Intergenic
1088513089 11:110598774-110598796 AGCCCTGCCCCTTCTGAGTTGGG + Intronic
1088897272 11:114088103-114088125 ATCTATACCTCTTCTGGTGTGGG - Intronic
1089505951 11:118961858-118961880 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1095138662 12:38637201-38637223 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1095283554 12:40384597-40384619 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1096172096 12:49479615-49479637 AGCCCTACCCCTTCTGAGTTGGG - Intronic
1096458595 12:51808260-51808282 CTTCATACACCTTCTGGGTAGGG + Exonic
1097423320 12:59409291-59409313 ACCCATATCCGGTCTGGGTTTGG + Intergenic
1100847737 12:98678404-98678426 AACCCTACCCCTTCTGAATTGGG + Intronic
1101764138 12:107682793-107682815 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1102060254 12:109926225-109926247 AGCCTTACCCCTTCTGGGTTGGG + Intronic
1104851875 12:131879993-131880015 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1107475592 13:40732788-40732810 TTCCCAGCCCCTTCTGGGTTAGG + Intronic
1108999348 13:56778279-56778301 ATCCATACAGCTTCTGGGGAGGG - Intergenic
1110008049 13:70297098-70297120 AGCACTACCCCTTCTGAGTTGGG + Intergenic
1110220774 13:73070620-73070642 ACCCATTCCCTCTCTGGGTTTGG + Intronic
1114383947 14:22237327-22237349 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1124407311 15:29404285-29404307 GTCCATATCCCTACTGTGTTTGG - Intronic
1128641851 15:69344515-69344537 ATCCATACCCCTGGTGGGGGTGG - Intronic
1129784909 15:78303813-78303835 ATGCCTCCCCCTTCTGAGTTGGG + Intergenic
1130954380 15:88616527-88616549 ACCCATACCCCTTCTTTCTTAGG - Intergenic
1131420219 15:92298859-92298881 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
1137352593 16:47726630-47726652 TTTCATGCCCCTTCTGGTTTGGG + Intergenic
1143289600 17:5818888-5818910 ACCCACATCCCTTCTGTGTTTGG - Intronic
1149448927 17:56734406-56734428 ATCCATGTCCCTTCTTGTTTGGG - Intergenic
1154507849 18:15060542-15060564 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1155224803 18:23719890-23719912 AGCCATCCACCTTCTGGATTGGG - Intronic
1155226919 18:23737191-23737213 CTCCATGTCCCTTCTGGGGTAGG + Intronic
1158773684 18:60552628-60552650 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1164056979 19:21630076-21630098 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1164173263 19:22746087-22746109 ATCCCCAACCCTTCTGGATTGGG + Intergenic
926859419 2:17292373-17292395 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
928476119 2:31629568-31629590 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
929779989 2:44951396-44951418 ACCCATTCCCCTTGTGGGCTGGG + Intergenic
935748447 2:106209899-106209921 AACCCCAACCCTTCTGGGTTGGG + Intergenic
936371811 2:111908072-111908094 ATACATACCCCTCCTGGGATGGG - Intronic
937361258 2:121231599-121231621 CTCCTTACCCCTCCTGGGCTGGG - Intronic
937912205 2:127081169-127081191 ACCCTTCCTCCTTCTGGGTTCGG - Intronic
938550491 2:132376431-132376453 ATCCACACCATTTCTGGATTAGG - Intergenic
941007287 2:160261144-160261166 CTCCTTACCCCTTCAGGCTTAGG - Intronic
941298136 2:163766364-163766386 AGCCAAACCCCTTTTGGGTCTGG - Intergenic
943023563 2:182602263-182602285 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
943961066 2:194264673-194264695 AGCCCTGCCCCTTCTGAGTTAGG + Intergenic
944615347 2:201453352-201453374 ATCCATAACCCTTCTGCTTGTGG + Intronic
945840383 2:214880666-214880688 ATCCATACATCTTCTGGGGTGGG - Intergenic
1170749288 20:19130879-19130901 ATCCATACCCCGTCTTTGTAAGG - Intergenic
1170878940 20:20277694-20277716 ATCCTTATCTCTTCTGGCTTTGG + Intronic
1174175612 20:48642585-48642607 CTCCACATCCCTTGTGGGTTTGG - Intronic
1176790233 21:13311257-13311279 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1177263882 21:18759593-18759615 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1177895827 21:26855375-26855397 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1177989406 21:28019466-28019488 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1181527946 22:23500905-23500927 ATCCACTCCCTCTCTGGGTTAGG + Intergenic
950178838 3:10896588-10896610 AGCCATTTCCCTTCTGGGTAAGG - Intronic
950325889 3:12109702-12109724 ATCTATAACTCTTCTGGGTTTGG + Intronic
950697545 3:14715042-14715064 ATTTCTTCCCCTTCTGGGTTTGG + Intronic
951257043 3:20462059-20462081 ACCCATACTCTTTCTGGGTCGGG - Intergenic
952922602 3:38296332-38296354 ACCCCCAACCCTTCTGGGTTGGG - Intronic
954053279 3:48000502-48000524 ATCCCTACCCCTATAGGGTTTGG + Intronic
958016642 3:87945648-87945670 ACCCCCAGCCCTTCTGGGTTGGG - Intergenic
958959677 3:100497028-100497050 AATCATACCCATTCTGGATTTGG + Intronic
962105408 3:132383683-132383705 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
962118197 3:132534151-132534173 CTCCATGCCCCTTCCTGGTTGGG - Intronic
963915414 3:150854967-150854989 ATCCCCAACCCTTCTGAGTTGGG + Intergenic
966491321 3:180531474-180531496 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
968391521 4:196748-196770 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
969644760 4:8421319-8421341 ATCCCCAACCCTTTTGGGTTGGG + Intronic
969720679 4:8891795-8891817 ATCCTTGCCCCATGTGGGTTGGG + Intergenic
976189382 4:82474222-82474244 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
977618338 4:99109231-99109253 AGCCCCAACCCTTCTGGGTTGGG - Intergenic
977789952 4:101088069-101088091 ATCCATTCCCCCTTGGGGTTAGG + Intronic
977874452 4:102132062-102132084 ATACATACCCCTTCTGCCTCAGG + Intergenic
979451051 4:120871349-120871371 TTCCAGACCCTTTCTGGGTATGG + Intronic
980443907 4:132882985-132883007 ATCCCCAACCCTTCTGGGTTGGG + Intergenic
983667341 4:170196377-170196399 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
983669816 4:170223133-170223155 TTCCATACACCTTTTGGGGTTGG - Intergenic
985626510 5:991680-991702 GTCCCTACCCCTCCTGGGGTTGG - Intergenic
990266669 5:54084218-54084240 TTCTAGACCCCTTCTGGGTTTGG - Intronic
995465262 5:112444648-112444670 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
997960281 5:138315912-138315934 AGCCCTTCCCCTTCTGAGTTGGG + Intronic
1001785118 5:174405233-174405255 ATCCTTGCCCCTTGTCGGTTCGG + Intergenic
1004236450 6:13879031-13879053 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1004696894 6:18042584-18042606 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1005324038 6:24682081-24682103 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1005599677 6:27413323-27413345 ATCCATACCTTTTATGGTTTGGG + Intergenic
1011190234 6:84720200-84720222 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1013021859 6:106228846-106228868 ACCCTCAACCCTTCTGGGTTGGG + Intronic
1013692886 6:112667175-112667197 GTCCCCACCCCTTCTGAGTTGGG + Intergenic
1015311561 6:131772662-131772684 ATCCAAACTCCTTATGGTTTTGG - Intergenic
1015520735 6:134128827-134128849 ATCCATCTCCCTTTTGGTTTTGG - Intergenic
1015663564 6:135603008-135603030 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1015854487 6:137608798-137608820 ATCCCAACCCCTTATTGGTTGGG - Intergenic
1018760661 6:166891854-166891876 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1019159308 6:170058454-170058476 CTCCACGCCCCTTCAGGGTTTGG - Intergenic
1020092883 7:5351169-5351191 GTCCCTACTCCTTCTGGGTGGGG + Intronic
1021561562 7:21972691-21972713 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1023788977 7:43737206-43737228 ACCCCTGCCCCTTCTGAGTTGGG + Intergenic
1024233231 7:47378658-47378680 ATCCATACCCCTTCTGGGTTTGG - Intronic
1024674088 7:51622588-51622610 AACCATCCACCTTCAGGGTTAGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028509547 7:91608857-91608879 GTCCATATCCCTTGTTGGTTTGG + Intergenic
1028588989 7:92477201-92477223 ACCCCCAACCCTTCTGGGTTGGG - Intronic
1030336919 7:108338026-108338048 ACCCCCAACCCTTCTGGGTTGGG + Intronic
1034154033 7:148939531-148939553 ATAAATTCCCCTTTTGGGTTAGG - Intergenic
1034430058 7:151036693-151036715 CTCCAGAGCCCTGCTGGGTTAGG + Intronic
1035434695 7:158850440-158850462 AGCCACATCCCTTCTGAGTTGGG - Intergenic
1037377713 8:18250000-18250022 TTCCATACTTCTGCTGGGTTAGG + Intergenic
1038663096 8:29513977-29513999 ATCCAAAGCTCTTCTGGGCTGGG + Intergenic
1040985176 8:53286443-53286465 ATCTCTACCCTTTGTGGGTTTGG - Intergenic
1043269524 8:78313941-78313963 ATCCATACCCCTTTTCTGTTTGG - Intergenic
1045391638 8:101721005-101721027 ACCCATGCCCCCTTTGGGTTGGG - Intronic
1049676421 8:143891263-143891285 GTCCACACCCCTTCTTGCTTGGG - Intergenic
1051211881 9:14753710-14753732 ATCCTTGCCTCTTCTGGGTCTGG - Intronic
1053617238 9:39781233-39781255 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1053875420 9:42540598-42540620 AGCCCCACCCCTTCTGAGTTGGG + Intergenic
1053897222 9:42754037-42754059 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054236280 9:62561126-62561148 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054266928 9:62926204-62926226 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1054550421 9:66595658-66595680 AGCCCCACCCCTTCTGAGTTGGG - Intergenic
1055572508 9:77631904-77631926 ATCCTCGCCCCTTCTGAGTTGGG + Intronic
1057548360 9:96034679-96034701 AGCCCTGCCCCTTCTGAGTTTGG + Intergenic
1058794889 9:108488498-108488520 TTCCATGCCCCTTCTAGCTTTGG + Intergenic
1059558037 9:115301028-115301050 TTCCACATCCCTTTTGGGTTTGG - Intronic
1061256302 9:129455585-129455607 ATCCACTCCCTCTCTGGGTTAGG - Intergenic
1062235316 9:135505187-135505209 ATCCCTGTCCCTTCAGGGTTAGG + Intergenic
1189360028 X:40343354-40343376 AGCCCTGCCCCTTCTGAGTTGGG + Intergenic
1189715994 X:43866833-43866855 CTCCATGCCCCTTCTGGATCTGG - Intronic
1192940280 X:75904352-75904374 AACCCCAACCCTTCTGGGTTGGG - Intergenic
1193172287 X:78349797-78349819 ACCCCCAACCCTTCTGGGTTGGG - Intergenic
1193306342 X:79956631-79956653 ACCCCCAACCCTTCTGGGTTGGG + Intergenic
1194136313 X:90147986-90148008 ATACATACATCTTCTGGTTTTGG - Intergenic
1194205223 X:91003298-91003320 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1195584699 X:106551952-106551974 ACCCCCAACCCTTCTGGGTTAGG + Intergenic
1200106879 X:153719174-153719196 AAACATACTCCTTCTGGTTTGGG + Intronic
1200551042 Y:4578435-4578457 AGCCCTGCCCCTTCTGAGTTGGG - Intergenic
1201385492 Y:13436002-13436024 CCCCATTCACCTTCTGGGTTAGG - Intronic