ID: 1024233693

View in Genome Browser
Species Human (GRCh38)
Location 7:47382028-47382050
Sequence CTGTATGTCTAGATATGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024233686_1024233693 21 Left 1024233686 7:47381984-47382006 CCGAGTCTCTCCTGAGCACCGGG 0: 1
1: 0
2: 1
3: 7
4: 195
Right 1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1024233689_1024233693 11 Left 1024233689 7:47381994-47382016 CCTGAGCACCGGGGTCTTTCCAA 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1024233691_1024233693 -8 Left 1024233691 7:47382013-47382035 CCAAACTGTAGCTAACTGTATGT 0: 1
1: 0
2: 2
3: 14
4: 140
Right 1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1024233690_1024233693 3 Left 1024233690 7:47382002-47382024 CCGGGGTCTTTCCAAACTGTAGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG 0: 1
1: 0
2: 1
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024233693 Original CRISPR CTGTATGTCTAGATATGGCT AGG Intronic
902975812 1:20087677-20087699 CTGTATATATATATATGACTTGG - Intronic
908871517 1:68618477-68618499 CTGTATGACCAGATTTGGGTGGG + Intergenic
909447566 1:75765080-75765102 CTTTATGTTTAGAAATGGTTGGG - Intronic
911803345 1:102173817-102173839 TTGTATTTTTGGATATGGCTTGG + Intergenic
911843930 1:102723911-102723933 ATGTATGTCAATATATGTCTTGG - Intergenic
916328212 1:163587439-163587461 CTGTTTGGCTTGATTTGGCTTGG - Intergenic
916399337 1:164429046-164429068 TTGTATGTCTAGATTTGGGATGG - Intergenic
917680404 1:177360398-177360420 CTGGATGTAAAGATGTGGCTTGG + Intergenic
918843173 1:189571835-189571857 CTGTATAACAAGACATGGCTAGG + Intergenic
920385554 1:205568643-205568665 CTGTATCTCCGGATAAGGCTAGG - Intergenic
921746164 1:218742971-218742993 GGGTATGTCTAGAAATGTCTGGG - Intergenic
1067010283 10:42705182-42705204 CTATATGTCTATATAGGGTTTGG - Intergenic
1067313479 10:45138395-45138417 CTATATGTCTATATAGGGTTTGG + Intergenic
1069235552 10:66067347-66067369 CTGTCTGTCTAGATTTTTCTTGG - Intronic
1071436875 10:85655520-85655542 CTGAATGGCTGAATATGGCTGGG + Intronic
1071831289 10:89374862-89374884 CTCTATGTGTAGATATGGCCAGG + Intronic
1072688149 10:97550993-97551015 CTGTTTGTTAAGATGTGGCTGGG + Intronic
1073791051 10:106940913-106940935 CTGTGTGGATAGAGATGGCTAGG + Intronic
1074093536 10:110286572-110286594 TTTTATGTTTAGATAGGGCTGGG + Exonic
1074899989 10:117807686-117807708 CTGCATGTCAAGAAATGCCTTGG - Intergenic
1082003305 11:47406330-47406352 GTGTATGGCCATATATGGCTGGG - Intergenic
1086076724 11:82862575-82862597 CTGTGTGTGTAGATAGAGCTGGG - Intronic
1086524962 11:87714367-87714389 CTGTATGTCTAGATTCTTCTTGG + Intergenic
1088468171 11:110164426-110164448 CCGTATTTCTAGACATGGCACGG - Exonic
1089022311 11:115229114-115229136 CTGTACTTCTAGATACCGCTGGG + Exonic
1090171499 11:124610135-124610157 GTGTTTGTCTATATATGTCTAGG - Intergenic
1093071691 12:14712114-14712136 CTGTATTTCTAGAAGTTGCTGGG - Intergenic
1094419748 12:30258009-30258031 GTGTTTGTCTAGAAATGTCTGGG - Intergenic
1097200243 12:57272388-57272410 CTGTATCTGTAGGTATGTCTGGG - Intronic
1099620193 12:84994078-84994100 GTATATGTTTAGATATGGTTGGG - Intergenic
1100432975 12:94546951-94546973 CTGCATGTCTGAATATGGATGGG + Intergenic
1101087300 12:101249417-101249439 CTGGATGTCTATATATGGTTAGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1103653385 12:122451171-122451193 CTGAATGTATATATATGGTTAGG - Intergenic
1106836533 13:33641111-33641133 CTGTGTGTCTAGATCCTGCTTGG + Intergenic
1107682639 13:42867272-42867294 TAGTGTGTCTAGATAAGGCTGGG - Intergenic
1107786555 13:43963513-43963535 TTTTATGTGTAAATATGGCTGGG - Intergenic
1108224656 13:48275808-48275830 CTGTACATCTAGAAATGGCTGGG - Intergenic
1108327581 13:49348752-49348774 CTGTATTTCCAGAGATGGCCTGG + Intronic
1109148482 13:58813701-58813723 GTGTATGTATATATATGACTTGG - Intergenic
1109933275 13:69245042-69245064 GTGTATGTCAATTTATGGCTTGG + Intergenic
1111933796 13:94538447-94538469 CTATGTGTATACATATGGCTTGG - Intergenic
1112234261 13:97621452-97621474 CTGTAAGTTTGGATATTGCTAGG - Intergenic
1115496538 14:34010457-34010479 CTGTATGGATAGATATCACTGGG + Intronic
1118041875 14:61925996-61926018 CTGTATGTCTGGATTATGCTTGG + Intergenic
1121023844 14:90599947-90599969 CTGTTTCTCAAGATAGGGCTTGG + Intronic
1121489851 14:94349914-94349936 CTGTATGTCTAACCATGGGTAGG + Intergenic
1125637945 15:41204940-41204962 CTGTCTGTCTAGATTCGTCTTGG - Intronic
1125761863 15:42102264-42102286 CTGTATTTCTAGATATAGTTTGG - Intergenic
1126375898 15:47996339-47996361 CTATAAGTCAAGATGTGGCTGGG + Intergenic
1127237380 15:57069627-57069649 CTGTATGTAGAGATTTGGCTAGG + Intronic
1128598478 15:68975541-68975563 CTTTATGTCTAGATAAGGGATGG - Intronic
1129706631 15:77798232-77798254 CTGTCTGACTAGACCTGGCTTGG - Intronic
1132315395 15:100886542-100886564 CTGTGTGTCCAGAGCTGGCTTGG - Intronic
1135082752 16:19450498-19450520 CTGTATGTATAGGTATGTCCTGG + Intronic
1139217888 16:65147005-65147027 ATGTATTTCTAGAAATGGCTGGG + Intergenic
1139229097 16:65265294-65265316 CTGTGAGTCTAGAGATGGCTAGG - Intergenic
1140145352 16:72301531-72301553 CTGAATGTCTAGAAATGACAGGG - Intergenic
1142655753 17:1392552-1392574 TTGTATGTCTATATCTGGCCGGG + Intronic
1142898411 17:2996949-2996971 CTGTATGTCGAGTCCTGGCTAGG - Intronic
1144432086 17:15201966-15201988 CTGTATTTCTAGATACAGTTTGG - Intergenic
1145075405 17:19850868-19850890 CTATATATCTAGATATAGATAGG - Intronic
1148622966 17:49048548-49048570 TAATATGTCTAGATATGGCCAGG - Intronic
1149404231 17:56330471-56330493 TTATATTTCTTGATATGGCTTGG - Intronic
1153699147 18:7675072-7675094 CTGTATTTCAAGATACAGCTTGG - Intronic
1156888921 18:42167263-42167285 TTTTATGTCTATATATGGGTAGG - Intergenic
1159277955 18:66245418-66245440 CTGTATTTCTAGGCATGTCTGGG - Intergenic
1161049400 19:2154752-2154774 CTGTCTGTCCAGATTTGTCTTGG - Intronic
1162604815 19:11698401-11698423 CTGTCTGTCTAGATTTTTCTTGG - Intergenic
1168063084 19:53905008-53905030 CTGTCTGTCTAGAACTGGGTGGG + Intronic
925015380 2:520384-520406 CTGAAAGTTTAGATCTGGCTGGG - Intergenic
927148690 2:20183547-20183569 TTGAATGTCTACATATGTCTTGG - Intergenic
930060422 2:47283809-47283831 CAGTGTGTCCAGATATGGCCTGG - Intergenic
930542716 2:52727597-52727619 CTGTATATTATGATATGGCTAGG + Intergenic
931654146 2:64494926-64494948 CTGTATTTCTAGATATAGTTTGG + Intergenic
931710410 2:64985288-64985310 CTTAATGGCTAGAGATGGCTAGG - Intergenic
932291224 2:70581673-70581695 GTGTATCTTTAGATATGCCTTGG + Intergenic
932763973 2:74458589-74458611 CTGTAGGTGGAGGTATGGCTCGG + Exonic
933909967 2:86930746-86930768 CTGTAGGTGGAGGTATGGCTCGG - Intronic
934022758 2:87972642-87972664 CTGTAGGTGGAGGTATGGCTCGG + Intergenic
935282460 2:101530116-101530138 ATGTATGTGTAGATATGTATGGG - Intergenic
935389243 2:102532986-102533008 TTGTATTTCAATATATGGCTTGG - Exonic
935896397 2:107742517-107742539 GTGACTGTCTTGATATGGCTGGG - Intergenic
935914992 2:107939671-107939693 CTGTAAGTCTACAGATGACTTGG - Intergenic
936885009 2:117299904-117299926 GGGTATGTCTAGAAATGTCTGGG - Intergenic
939600022 2:144177186-144177208 CTTCATGTCTGGATATGGTTTGG - Intronic
939916862 2:148055874-148055896 CTGTAAGTTTAGATAAGTCTTGG + Intronic
940559851 2:155281429-155281451 CGGTATGTCTATAAATGTCTAGG + Intergenic
942908118 2:181207784-181207806 CTTGATATCTTGATATGGCTTGG - Intergenic
1169872699 20:10264299-10264321 CTGTATGTCTGGATATAAATAGG - Intronic
1170915920 20:20625295-20625317 CTATATGTGTATATATGGCTGGG - Intronic
1172652538 20:36514197-36514219 CTGCCTTTCTAGATCTGGCTTGG - Intronic
1172711266 20:36925604-36925626 CTTTATGTATATATATGGTTAGG - Intronic
1173088685 20:39949924-39949946 CCATATGTCTAGCTCTGGCTGGG - Intergenic
1173863809 20:46301513-46301535 ATATATGTATATATATGGCTGGG + Intronic
1175241329 20:57551634-57551656 CTGTCTGTCTAGAGATGTATTGG + Intergenic
1177394549 21:20515276-20515298 CTTTATGTATACATATGGCCAGG - Intergenic
1177643415 21:23872511-23872533 CTGTATGTCTTGTTTTGCCTGGG + Intergenic
1177737836 21:25115199-25115221 TTCTATGTTTAGATATGGTTAGG - Intergenic
1178394688 21:32232167-32232189 CTATATATCTAGATATTTCTAGG + Intergenic
1181485105 22:23225564-23225586 CTGTAGGTCTGGAGGTGGCTGGG + Intronic
952204484 3:31166656-31166678 GTATATGTATATATATGGCTGGG + Intergenic
952302614 3:32117125-32117147 CTTTATGTATAGATATGGAAAGG - Intronic
953591484 3:44259869-44259891 GTGTATGTCCTGATATGGTTTGG + Intronic
957682420 3:83454062-83454084 CATTATGTCTAGTTATGGATTGG + Intergenic
963100257 3:141595249-141595271 CTGTAATTATTGATATGGCTGGG - Intronic
963256577 3:143151088-143151110 TTGTGTCTCTAGATCTGGCTGGG + Intergenic
964405609 3:156345533-156345555 TTGTATGACTACATTTGGCTGGG + Intronic
966050090 3:175605339-175605361 TTTTATTTCTAGATATGGATGGG + Intronic
967674217 3:192276876-192276898 CTGTCTGTCTAGATTTTTCTTGG - Intronic
968319540 3:197752706-197752728 GTGTATGTCTATATATGGCTTGG + Intronic
971215611 4:24659642-24659664 CTGTATGCAAAGATATTGCTTGG + Intergenic
971588363 4:28433840-28433862 TTGTATGTCAAGAGATAGCTAGG + Intergenic
981610461 4:146588758-146588780 CTGCATGTATAGGTAAGGCTTGG - Intergenic
983308795 4:166028728-166028750 CTTTATTTCTAGAGATGGTTTGG + Intronic
988886181 5:35560352-35560374 CTGTATTACTTGATATGGTTTGG - Intergenic
988893635 5:35648040-35648062 CTGTATGTCAAGCTGTGGATTGG + Intronic
989395250 5:40948626-40948648 CTATCTGTCTAGATATGGGCAGG + Intronic
989551961 5:42745925-42745947 CTGTATCTCTATATCTGGCGAGG + Intergenic
992212000 5:74489482-74489504 TTCTATGTTTAGATATGTCTAGG + Intergenic
993144156 5:84073022-84073044 CTGCATGTCTAGATTTGACAGGG + Intronic
994006232 5:94840579-94840601 CTTTATGTCTAGTTTTGGGTTGG + Intronic
995757415 5:115523217-115523239 CTAGATGCCTAGATCTGGCTTGG + Exonic
995957909 5:117802201-117802223 AATTATGTCTTGATATGGCTTGG + Intergenic
996936085 5:128950341-128950363 CTGTCTGTCTAGATTTTTCTTGG + Intronic
999818332 5:155199848-155199870 CTGTCTGTCTAGATGTCTCTTGG - Intergenic
1000292323 5:159882008-159882030 CTGTGTTTCCAGAGATGGCTAGG - Intergenic
1001108953 5:168879466-168879488 CTGTATGTTTAAATATGCATCGG - Intronic
1001276285 5:170353990-170354012 CTTTCTGTCTTGATATGGCCTGG + Intronic
1005888681 6:30117903-30117925 CTGTATGTAGTCATATGGCTAGG + Intergenic
1008547169 6:52593435-52593457 CTATATTTCCAGTTATGGCTGGG + Intergenic
1008954203 6:57197608-57197630 CTGTATATCTATATATCACTGGG + Intronic
1012902493 6:105022518-105022540 CTGTCTGTCTAGATTTTTCTTGG + Intronic
1015030273 6:128586508-128586530 AGGTATGTCTAGAAATGTCTGGG - Intergenic
1018324182 6:162646838-162646860 CTCCATGTCTAGATATGTTTAGG - Intronic
1018516563 6:164586114-164586136 CTTTATGTGTAAATATGTCTAGG + Intergenic
1023140263 7:37094776-37094798 CAGAATGTCTAGAAATGGATTGG - Intronic
1024233693 7:47382028-47382050 CTGTATGTCTAGATATGGCTAGG + Intronic
1024861492 7:53847873-53847895 CTATATGTATATATATGGTTTGG + Intergenic
1025118412 7:56278392-56278414 CTGTATGTCTAGAGTGGGCAGGG + Intergenic
1026547119 7:71332981-71333003 CTGTATATCTCAGTATGGCTGGG - Intronic
1029911324 7:104152013-104152035 CTGTATGTCTATAGATGGGCAGG + Intronic
1034594614 7:152177881-152177903 CAGTATCTGTAGATATGCCTAGG - Exonic
1038253744 8:25930827-25930849 CTGTGTGTCCAGAGATGGCCTGG - Intronic
1038404876 8:27314093-27314115 CTGTCTGTCTAGATTTTTCTTGG - Intronic
1039164420 8:34661186-34661208 CTGTATATATATATATGGCAAGG - Intergenic
1043786836 8:84413469-84413491 CTATATATTTAGATATGGTTTGG + Intronic
1045265571 8:100616072-100616094 CTCTATGTCTAGATATGTTTTGG - Intronic
1046236500 8:111429948-111429970 CAGTATGTGTAGATATGACATGG + Intergenic
1050311603 9:4358932-4358954 CTGTAGTTCAAGATGTGGCTGGG + Intergenic
1051382555 9:16472991-16473013 CTGTCTGTCTAGATGTGCCTTGG - Intronic
1051796560 9:20878402-20878424 CTGAAAGTCTAGTTATTGCTCGG + Intronic
1052449763 9:28613510-28613532 CAGTATGTCTACATATAGGTAGG - Intronic
1052532411 9:29704600-29704622 CTTTATGTCTAGAGCTGGCCTGG - Intergenic
1054842017 9:69752870-69752892 AAGTATAGCTAGATATGGCTAGG - Intronic
1056372844 9:85974814-85974836 CTGCTTGTCTAAATATTGCTAGG - Intronic
1056799854 9:89683492-89683514 ATATATGTCTGGATCTGGCTAGG - Intergenic
1185755432 X:2649781-2649803 ATGGATGTCTAGACATGTCTAGG + Intergenic
1186651169 X:11561872-11561894 CTGGATGTCCACACATGGCTAGG + Intronic
1187842336 X:23501669-23501691 CTGTCTGTCTAGATTTTTCTTGG - Intergenic
1188254728 X:27947847-27947869 CTGTGTCTCTAAATACGGCTTGG - Intergenic
1195712632 X:107786182-107786204 CTGTATGTCAATATATGGAGTGG - Intronic
1197099599 X:122636882-122636904 GTGTATGTCTAGAGTTGTCTGGG + Intergenic
1198953706 X:142102961-142102983 CTGTATTTCTAGATAGTACTAGG + Intergenic
1199073100 X:143501483-143501505 CTGTATGTCTAGATTATTCTTGG + Intergenic
1199215626 X:145257276-145257298 CTGTATGTCTAGATTATTCTTGG - Intergenic