ID: 1024236282

View in Genome Browser
Species Human (GRCh38)
Location 7:47401629-47401651
Sequence CCACATGCCAAGCATCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024236282_1024236289 -3 Left 1024236282 7:47401629-47401651 CCTTGCAGATGCTTGGCATGTGG 0: 1
1: 0
2: 1
3: 15
4: 183
Right 1024236289 7:47401649-47401671 TGGGGAACGGTGGGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024236282 Original CRISPR CCACATGCCAAGCATCTGCA AGG (reversed) Intronic
901812741 1:11777015-11777037 CAACATGCCAGGCACCTGCAGGG - Intronic
901908615 1:12436319-12436341 CCACATGGCAAGCATCTCCTTGG - Intronic
903129687 1:21270689-21270711 CAACATGCCAAGCCTAGGCATGG + Intronic
903820092 1:26095200-26095222 CCAAATGTCAAGCACCTGAAAGG - Intergenic
905809035 1:40898668-40898690 CCACATACCAAGCAAATGCCAGG - Intergenic
906896073 1:49773813-49773835 ACACAGGCCCAGCAGCTGCAAGG + Intronic
907862779 1:58369599-58369621 CCACATGCCTAGCATGGGCAAGG + Intronic
908158238 1:61378854-61378876 CCACATGGTAAGGAACTGCAGGG - Intronic
909039412 1:70631071-70631093 CCACATGTACAGCATCAGCAGGG - Intergenic
909514921 1:76496566-76496588 ACACATGCACAGCATCTTCAAGG + Intronic
910754573 1:90673885-90673907 CCACAGGGCAAGGAACTGCAGGG - Intergenic
914442447 1:147719289-147719311 CCCCATGCACAGCATCAGCAGGG - Intergenic
916788319 1:168102678-168102700 AAACATGCCAGTCATCTGCAGGG - Intronic
918115771 1:181496412-181496434 CCAGATGCCAAGGATCTAAAGGG - Intronic
918140837 1:181718100-181718122 CCCCATGCCATACATCTTCAGGG - Exonic
920684806 1:208101349-208101371 CCACCTGCCAAGCAGCAGCCTGG - Intronic
921964338 1:221072044-221072066 TTACATGCCAAACATCTGCATGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063438944 10:6056517-6056539 CCTCAAGCCATCCATCTGCATGG - Intronic
1064638047 10:17388591-17388613 CCACATGCCAATCCTATACAAGG - Intronic
1064895888 10:20235997-20236019 TCTCATGCCAAGCCTTTGCATGG - Intronic
1065339994 10:24695793-24695815 CCTCAATCCAAGCACCTGCAGGG + Intronic
1065617339 10:27541840-27541862 CCACATGCCAATTGTTTGCAGGG - Exonic
1069855233 10:71436650-71436672 CCACAGGCCAAGGATTTTCACGG - Intronic
1071979200 10:90986798-90986820 CCACATTCCCAGCATCTGGGAGG - Intergenic
1074831139 10:117250235-117250257 ACACAGGCCAAGCCACTGCATGG - Intronic
1076184014 10:128432533-128432555 CGACAGGCGGAGCATCTGCAGGG - Intergenic
1077088534 11:766902-766924 CCCCATGCCCAGCTACTGCAGGG - Intergenic
1079347094 11:19662571-19662593 CCACATGTCAGGCAGCTGGAGGG + Intronic
1080349105 11:31361277-31361299 CAAGATGGCATGCATCTGCAAGG + Intronic
1080654800 11:34250363-34250385 CTACATGCCAGACATCTTCATGG - Intronic
1081584791 11:44376871-44376893 CCACAGGCACAGCATCTGGAAGG - Intergenic
1082278633 11:50246934-50246956 CCACTTGGCCAGCATCCGCAGGG + Intergenic
1083265096 11:61542929-61542951 CAACATGACAGGCAGCTGCAGGG - Intronic
1084356455 11:68641877-68641899 CCACATGCCTCGCAGCTGCTGGG - Intergenic
1084793839 11:71491237-71491259 CGGCCTGCCAAGCATCGGCATGG - Intronic
1084993728 11:72955019-72955041 CCACATGCCAAGCAATTCCCTGG + Intronic
1085698421 11:78725453-78725475 GCAAATGTCAAGCCTCTGCAGGG - Intronic
1086369479 11:86142069-86142091 CCATGTGCCAGGCATCAGCATGG + Intergenic
1088684997 11:112277278-112277300 CCAAATACCTAACATCTGCAAGG - Intergenic
1088686006 11:112285018-112285040 CCACAAGCTCACCATCTGCAAGG - Intergenic
1089327422 11:117666865-117666887 CCACGTGCCACGCATCTGCTAGG - Intronic
1089757212 11:120695773-120695795 CAACCTGCCAGGCCTCTGCAGGG - Intronic
1090719809 11:129460835-129460857 ACACATCCCAAGCTTCTGTATGG - Intergenic
1091047115 11:132334600-132334622 CCACAGGCCAAGCAGCTGGAGGG + Intronic
1091693061 12:2610238-2610260 GCACATGCCAGGCATCACCAGGG + Intronic
1094491352 12:30962889-30962911 ACACATGCACAGCATCTTCAGGG - Intronic
1096812622 12:54181371-54181393 CCACATGCCAAGCCCATGCAAGG + Exonic
1098125710 12:67290784-67290806 CAACAGGCCAAGGATCTGTATGG - Intronic
1101726018 12:107388666-107388688 CCACTTGCCAGGCCCCTGCATGG - Intronic
1101760955 12:107658548-107658570 CCACATAACATGCATTTGCATGG + Exonic
1102417840 12:112779958-112779980 CCACAAGCCAAGAAACTGCAAGG + Intronic
1102583432 12:113906974-113906996 CCCCATGCCAAGCAATAGCAGGG + Intronic
1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG + Intergenic
1104118689 12:125775571-125775593 CCACATGCTAAACATCAACAGGG + Intergenic
1105443092 13:20431395-20431417 GCACTTGCCCAGCTTCTGCAGGG - Intronic
1105963672 13:25366107-25366129 CCACAAGACCAGCATCTTCACGG - Intergenic
1106226587 13:27791080-27791102 CCAAACCCGAAGCATCTGCATGG - Intergenic
1106446960 13:29842654-29842676 TAAAATGCCAAGCATCTGCCTGG + Intronic
1106942922 13:34796769-34796791 CCACATGTCAAGGATGGGCAAGG + Intergenic
1108075211 13:46672362-46672384 CCATGTGCCACCCATCTGCACGG - Intronic
1112682319 13:101780919-101780941 CCACAGCCCATGCACCTGCATGG + Intronic
1113709946 13:112456569-112456591 CCACATTCCCAGCAGCTGGAAGG + Intergenic
1122873282 14:104651118-104651140 CCCCATCCCCAGCATCTGCCGGG + Intergenic
1122951344 14:105046910-105046932 CCACATGCCAGGAGGCTGCAGGG + Intergenic
1129491805 15:75934208-75934230 CCACATTCCAAGCAACAGGATGG - Exonic
1132641112 16:979042-979064 CCACAAGGCCAGCGTCTGCAGGG + Intronic
1133166221 16:3949511-3949533 CCAGCTGCCAAGCAGCTGCCTGG + Intergenic
1134588604 16:15434291-15434313 CCCCATGCCAAGCATCACTAGGG + Exonic
1135979452 16:27136030-27136052 CTACAAGCCAAGTACCTGCAAGG + Intergenic
1136307696 16:29383418-29383440 ACACCTGCCGAGCATCTGCGGGG - Exonic
1136307738 16:29383670-29383692 ACACCTGCCGAGCATCTGCGGGG - Exonic
1138421930 16:56904604-56904626 CCACATGCTAAGAATCGCCAGGG - Intronic
1139163634 16:64540162-64540184 CCCCATGACAAGCATCTGCTTGG - Intergenic
1139271403 16:65686903-65686925 TCACATGCCTAGCGTGTGCAAGG - Intergenic
1140047144 16:71448244-71448266 CCACATTCCACACATCTGAAGGG + Exonic
1142581349 17:945035-945057 CAACATGCCAGGCAAGTGCATGG + Intronic
1143097483 17:4486144-4486166 CCACCTGCCAAGGACCTGCCTGG - Intronic
1143282752 17:5766959-5766981 CCACACACCAGGCAGCTGCAGGG - Intergenic
1143982350 17:10880804-10880826 CCACATGTAAAGCATCCTCAAGG - Intergenic
1144028262 17:11297496-11297518 CCACACTCCAAGCATCAGGATGG + Intronic
1144594160 17:16552685-16552707 CCACATTCCAAGCATTTATATGG + Exonic
1145006808 17:19343013-19343035 CCACATGCCATCCTGCTGCACGG + Intronic
1148128728 17:45249950-45249972 CTACATGCCAGGCACCAGCAGGG - Intergenic
1151677122 17:75604341-75604363 CCACATCCCCAGAACCTGCACGG + Intergenic
1155195335 18:23469028-23469050 CCCCATGGCAAGGAACTGCAGGG - Intronic
1160064166 18:75559655-75559677 CCATTTGCCAAGGCTCTGCAGGG - Intergenic
1160442274 18:78901967-78901989 CCACACGCCAAACCCCTGCAGGG + Intergenic
1160442312 18:78902154-78902176 CCACACGCCAAACCCCTGCAGGG + Intergenic
1160442352 18:78902339-78902361 CCACACGCCAAACCCCTGCAGGG + Intergenic
1161580534 19:5078230-5078252 GCACGTGCCAAGAACCTGCAAGG + Intronic
1162307737 19:9885587-9885609 ACACCTCCCAAGCATCTCCAAGG - Intronic
1167608281 19:50493307-50493329 CCACCCGCCAAGTGTCTGCAGGG + Intergenic
1168557659 19:57356617-57356639 CCACATGGTAGGCATCTGAAGGG - Exonic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
926752781 2:16211548-16211570 CCACATTCCAAACATCAGGATGG - Intergenic
927512538 2:23653387-23653409 GGACAAGCCCAGCATCTGCATGG + Intronic
931370744 2:61660462-61660484 CCACATGCCAAGTCTCTTCTAGG - Intergenic
932219478 2:69989072-69989094 CCACTTTGCAAGAATCTGCATGG + Intergenic
934518390 2:95003838-95003860 CAAGAGGCCAAGCATCTGCTGGG - Intergenic
935134070 2:100283985-100284007 CCACATGTAAACCATCTGCAGGG + Exonic
937820644 2:126306846-126306868 CCACATGCTAAGAATAGGCAAGG - Intergenic
938212902 2:129483541-129483563 CCACATGCCCACCATGTGTAGGG + Intergenic
938255839 2:129859051-129859073 CCACCTGCCTAGGATCTGGACGG + Intergenic
946283967 2:218688613-218688635 ACACATACCAAGCATCCCCAAGG - Intronic
946416117 2:219540579-219540601 CCACGGGCCAAGCAGCTGCCTGG + Exonic
947125553 2:226864915-226864937 ACAAATGCCAATCATCAGCATGG - Exonic
948245886 2:236485699-236485721 ACACATTCCAAGCTACTGCAGGG + Intronic
1168924178 20:1566061-1566083 TCACATGCCATGCAGCTTCAGGG - Intronic
1168931780 20:1630130-1630152 CCACATGCCATGCAGCACCAGGG - Intronic
1168958688 20:1853274-1853296 CCACTTGCAAAGCATTTTCATGG + Intergenic
1170114835 20:12846346-12846368 TCACAAGCCAAGCATCTCCTGGG - Intergenic
1173067577 20:39727961-39727983 CCACCTGCTCAGCATCTCCAGGG + Intergenic
1173242845 20:41313065-41313087 CCACATGCAACCCATCTGTATGG - Intronic
1174762767 20:53222706-53222728 CCAAATGCCCAGAATCAGCAAGG + Intronic
1175259355 20:57664819-57664841 CCACACCCAAGGCATCTGCAGGG + Intronic
1175329531 20:58153795-58153817 CCACATGCCAGGCATGTTCTAGG + Intronic
1175938695 20:62527210-62527232 CCCCCTGCCCAGCATGTGCACGG + Intergenic
1176902118 21:14454879-14454901 CCTCTTGACAAGCATCTACAAGG - Intergenic
1177089066 21:16743451-16743473 CCACATTCCCAGAAGCTGCAGGG + Intergenic
1179376943 21:40857987-40858009 GCACATGCCATGCCTCTGCAAGG - Intergenic
1180626545 22:17197638-17197660 CTACATGCCAGGCATATGCAGGG + Intronic
1181130593 22:20729309-20729331 CCACCTGGCAGGCAGCTGCACGG + Exonic
1182427513 22:30282780-30282802 CCTGGTGCCCAGCATCTGCAGGG - Intergenic
1183764075 22:39854119-39854141 CCACTTCCCAAGGATGTGCACGG - Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
1184862041 22:47177676-47177698 CTCCATGCCAAGGAGCTGCAGGG - Intergenic
1184952691 22:47855536-47855558 CCACACGCCAAGCATTTTCTGGG - Intergenic
952802626 3:37310449-37310471 CCAACTGCCAAGCATATGCTAGG - Intronic
953472720 3:43180704-43180726 CCCCATGGGCAGCATCTGCAAGG + Intergenic
954040665 3:47884915-47884937 CCACATCACCAGCAACTGCAGGG - Intronic
955230492 3:57094993-57095015 CCACCTGCCATGCATGTGCTTGG + Exonic
955475194 3:59329182-59329204 CTATATTCCAAGCATCTGCATGG - Intergenic
958700083 3:97577938-97577960 CCAGATGCCACTCATCTGCCTGG - Intronic
959919662 3:111857027-111857049 CCTCCTCCCAAGTATCTGCATGG - Intronic
960999639 3:123365502-123365524 CCCCAAGCAAGGCATCTGCAAGG + Intronic
968866275 4:3214037-3214059 CCAGAGGCCAGGCAGCTGCAGGG - Exonic
969432907 4:7166447-7166469 CCACAAGCCAAGGAACTCCAAGG + Intergenic
969832225 4:9807093-9807115 CCACATGCCAGCCAGCTGGATGG - Intronic
970138705 4:12956185-12956207 CCACATTCCAACCATCAGAAAGG + Intergenic
970232866 4:13928666-13928688 CCACTTACGAAGCTTCTGCAAGG - Intergenic
972900595 4:43677644-43677666 CCACATGCCAAGCATCTTCTAGG - Intergenic
973760902 4:54114680-54114702 CCAAAGGCAAAGCATCTGGAAGG + Intronic
978436825 4:108694609-108694631 GCACATACCAAGCTACTGCAGGG + Intergenic
981781520 4:148436089-148436111 CCACATTGCTAGCATGTGCAGGG + Exonic
984527780 4:180876940-180876962 CCAGCAGCCAAGCAGCTGCAGGG + Intergenic
986130286 5:4923696-4923718 CCACCTGAAATGCATCTGCATGG + Intergenic
987299094 5:16581008-16581030 CCACCTGCCTGGCAGCTGCAGGG + Intronic
987831771 5:23104643-23104665 CCACATGGCAAGCCTCTTCAGGG - Intergenic
988964211 5:36400407-36400429 CCACATTCCAAGCTGCTGCCTGG + Intergenic
992266153 5:75020236-75020258 CCCCGTGCACAGCATCTGCAGGG - Intergenic
992884138 5:81140930-81140952 CCTCATGGCAACAATCTGCAGGG - Intronic
996756543 5:126941789-126941811 CCACATGCCAAGTGTTTGGATGG - Intronic
997565016 5:134880347-134880369 CCACATGACAAAAATCTTCAAGG - Intronic
1000743929 5:165006596-165006618 CCAGATGCCTAGAATTTGCAAGG - Intergenic
1000900348 5:166904746-166904768 CCACATGGCGACCATCTGCTGGG - Intergenic
1001017271 5:168152936-168152958 CCACACCCCAAGCCTCTGGAAGG - Intronic
1001556213 5:172639205-172639227 CCACATGTCAGGCAACTGCTGGG + Intergenic
1003911434 6:10747549-10747571 CCCCAGGCCCAGCACCTGCAGGG - Intergenic
1004418739 6:15448730-15448752 CCACATTCCAACCAGCTGCCAGG - Intronic
1005590380 6:27319048-27319070 CCAGATGCCAAGTATCATCATGG - Intergenic
1013374747 6:109503738-109503760 CCAGGTGCCCAGCAGCTGCAGGG - Intronic
1016828397 6:148409176-148409198 CCAAATTCTAAGCATCTGGATGG + Intronic
1018478176 6:164163584-164163606 CCATATGCCAAGAAGCTGCATGG - Intergenic
1019191295 6:170252440-170252462 CCACTCGCCAAGCATGTGCTGGG + Intergenic
1019743971 7:2689232-2689254 CCAAAGGCCAGGCATCTGCGTGG + Intronic
1023262399 7:38371072-38371094 CCACATGTCAGGCAGCTGCTGGG - Intergenic
1024236282 7:47401629-47401651 CCACATGCCAAGCATCTGCAAGG - Intronic
1024563817 7:50665591-50665613 CCAAATGCTGAGCAGCTGCAGGG + Intronic
1024713963 7:52053305-52053327 GCAGTTGCCAAGCATCTGGAGGG - Intergenic
1028959657 7:96734502-96734524 CCACATGCAATGAATCTGAATGG + Intergenic
1030397134 7:109000295-109000317 TCACATCCCAAGCATATGCCAGG + Intergenic
1030480948 7:110102939-110102961 CCACATATCAAGTACCTGCAGGG - Intergenic
1031066562 7:117111787-117111809 AGACATGCCCAGCCTCTGCAGGG + Intronic
1034139789 7:148804742-148804764 CCACATGACAGGAATCTGAAGGG + Intergenic
1035903125 8:3479196-3479218 CCACATGCCAAGCCTAAACAAGG + Intronic
1039147296 8:34463242-34463264 ATACATGCCAAGCAGCTGGATGG + Intergenic
1039599820 8:38826580-38826602 CCAAATGAAAAACATCTGCATGG - Intronic
1041721158 8:60976766-60976788 CCCCATGGCAAGCAGATGCAGGG - Intergenic
1047758910 8:127939606-127939628 CCACGTGCCAAGCAGCTCAAAGG - Intergenic
1048153853 8:131922100-131922122 CCACAAGCCAAGGAACTCCAAGG - Intronic
1049235889 8:141512128-141512150 CCATGTGCCCAGCATCTGGAGGG - Intergenic
1049638393 8:143701945-143701967 CCACAATCCAGGCATCAGCAGGG + Intronic
1049851930 8:144837261-144837283 GCACAGGCCAAGCTCCTGCAGGG - Intronic
1053316314 9:37054812-37054834 CCACATGCCATTCCTCTGCTAGG - Intergenic
1053940914 9:43247951-43247973 CCACATGCCAAGTATTTAAAAGG - Intergenic
1054739087 9:68786833-68786855 CCACTTACCAAGCAGCTTCACGG + Intronic
1055194869 9:73577717-73577739 CTACATGCCAAGCCTTTGAAAGG - Intergenic
1057214685 9:93221151-93221173 CCCCATGCCCAGCATGAGCACGG - Intronic
1058143397 9:101382398-101382420 CCACATCCCAAGCACAAGCAGGG + Intronic
1058747930 9:108009831-108009853 CCACATGCCAGGCCTGTGCCAGG + Intergenic
1061101859 9:128498295-128498317 CATCATGCCAAGAATCTCCAAGG - Intronic
1062194875 9:135267351-135267373 GCGCCTGCCGAGCATCTGCATGG + Intergenic
1188482897 X:30653116-30653138 CCCCATGCCATGCAGCTGGATGG + Intergenic
1195000077 X:100635570-100635592 CTACCTGCCGAGCTTCTGCATGG - Exonic
1197914144 X:131516571-131516593 CCACAGCACAAGCATCTGCCAGG + Intergenic
1198173288 X:134129150-134129172 CCACATGCCACTCACTTGCAGGG + Intergenic
1198260904 X:134964034-134964056 CCTCTTGCTAAGTATCTGCATGG + Intergenic
1200696484 Y:6365560-6365582 CCACAGCCCAAGCAGATGCACGG + Intergenic
1201037629 Y:9799139-9799161 CCACAGCCCAAGCAGATGCACGG - Intergenic