ID: 1024237662

View in Genome Browser
Species Human (GRCh38)
Location 7:47410107-47410129
Sequence GCCTCCTAGGAAACAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024237650_1024237662 24 Left 1024237650 7:47410060-47410082 CCAACGATCCCAGGAAGTGTCCT 0: 1
1: 0
2: 2
3: 5
4: 95
Right 1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG No data
1024237653_1024237662 16 Left 1024237653 7:47410068-47410090 CCCAGGAAGTGTCCTGGGAGAAG 0: 1
1: 0
2: 2
3: 28
4: 254
Right 1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG No data
1024237659_1024237662 -10 Left 1024237659 7:47410094-47410116 CCTCCAGGGTGAAGCCTCCTAGG 0: 1
1: 0
2: 3
3: 8
4: 175
Right 1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG No data
1024237657_1024237662 4 Left 1024237657 7:47410080-47410102 CCTGGGAGAAGGAGCCTCCAGGG 0: 1
1: 0
2: 1
3: 172
4: 4109
Right 1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG No data
1024237654_1024237662 15 Left 1024237654 7:47410069-47410091 CCAGGAAGTGTCCTGGGAGAAGG 0: 1
1: 1
2: 2
3: 35
4: 313
Right 1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024237662 Original CRISPR GCCTCCTAGGAAACAAGCCC AGG Intronic
No off target data available for this crispr