ID: 1024239576

View in Genome Browser
Species Human (GRCh38)
Location 7:47423960-47423982
Sequence CATGCCAAAGACTGTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024239576_1024239579 1 Left 1024239576 7:47423960-47423982 CCACCTTCACAGTCTTTGGCATG 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1024239579 7:47423984-47424006 CCCAAGAATACTATTCATTTAGG 0: 1
1: 0
2: 0
3: 11
4: 188
1024239576_1024239583 15 Left 1024239576 7:47423960-47423982 CCACCTTCACAGTCTTTGGCATG 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1024239583 7:47423998-47424020 TCATTTAGGTGTCGGGACAGAGG 0: 1
1: 0
2: 1
3: 5
4: 96
1024239576_1024239581 7 Left 1024239576 7:47423960-47423982 CCACCTTCACAGTCTTTGGCATG 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1024239581 7:47423990-47424012 AATACTATTCATTTAGGTGTCGG 0: 1
1: 0
2: 0
3: 9
4: 192
1024239576_1024239582 8 Left 1024239576 7:47423960-47423982 CCACCTTCACAGTCTTTGGCATG 0: 1
1: 0
2: 0
3: 26
4: 195
Right 1024239582 7:47423991-47424013 ATACTATTCATTTAGGTGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024239576 Original CRISPR CATGCCAAAGACTGTGAAGG TGG (reversed) Intronic
900667343 1:3824468-3824490 CATGAAAAAGACTGGCAAGGTGG + Intronic
901013492 1:6214016-6214038 CTTGAGAAAGAGTGTGAAGGAGG + Intronic
902347053 1:15825944-15825966 GATGCCAGAGACTGTGATGTTGG - Intergenic
903316187 1:22509212-22509234 CCTGGCAGAGACTGTGAAAGAGG + Exonic
904027598 1:27514218-27514240 CAAGCCACAGACTGGGAAGGAGG + Intergenic
904273983 1:29368445-29368467 CATGGCAGAGACTGAGAAAGAGG + Intergenic
904694597 1:32321823-32321845 CAGGCCAAACTCTGTGCAGGAGG + Intronic
905017063 1:34785203-34785225 CATGCCAGAGAGTGTGCAGCAGG - Exonic
906194315 1:43920498-43920520 CAGGCCAATGAGGGTGAAGGCGG - Exonic
908936323 1:69381338-69381360 TAACCCAAAGACTGTGAAGGAGG - Intergenic
911479495 1:98419908-98419930 CAAGACAAAGACTGTTGAGGAGG + Intergenic
911588044 1:99713958-99713980 CATGGCAAAGACTATAAAGCAGG + Intronic
913093710 1:115497035-115497057 CATGACAAAGACTGTGGTGCTGG + Intergenic
914719925 1:150281571-150281593 GATTCGAAAGACTTTGAAGGAGG - Intergenic
916575211 1:166060601-166060623 CATGGCAGAGACTGAGAAGGAGG - Intronic
918854120 1:189729021-189729043 AATTCAAAAGACTGAGAAGGAGG - Intergenic
920863970 1:209735952-209735974 CCTACCAAGGATTGTGAAGGAGG + Intergenic
921148513 1:212381648-212381670 CATGCCCAGGCCTGGGAAGGTGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922301787 1:224308091-224308113 CCTGCCAAAGATTCTGAAGGAGG - Exonic
922606365 1:226892141-226892163 GAAGCCAAGGACTATGAAGGGGG + Intronic
1063996344 10:11623529-11623551 AGTGCCTAAGACTGGGAAGGGGG + Intergenic
1065219272 10:23479538-23479560 CTTGCCAAATACTGTGGAGTTGG - Intergenic
1068367610 10:56070901-56070923 AATGCAAAAGAATGTGGAGGTGG - Intergenic
1069310140 10:67024742-67024764 CATGCCAAAGAATGTTTAGTAGG - Intronic
1070101989 10:73397190-73397212 CCTCCATAAGACTGTGAAGGTGG + Exonic
1071823366 10:89300250-89300272 GATACCAGAGACTGGGAAGGGGG + Intronic
1072277655 10:93838740-93838762 CATCTCAAAGAAAGTGAAGGAGG - Intergenic
1073180505 10:101580251-101580273 CCTGCCGAAGACTGTCAAGGAGG + Exonic
1073401900 10:103264497-103264519 GTTGCCAAAGACAGTGATGGGGG + Intergenic
1079084342 11:17434260-17434282 CAAGCCCCAGAATGTGAAGGAGG - Intronic
1079522169 11:21340745-21340767 AATGCCAAAGATTGTGAAGATGG + Intronic
1079701599 11:23555538-23555560 CTTGTCCAAGACTGTCAAGGTGG - Intergenic
1079819220 11:25104734-25104756 CAGGAGACAGACTGTGAAGGGGG + Intergenic
1080639998 11:34153066-34153088 ACTGCAGAAGACTGTGAAGGAGG + Intronic
1080976136 11:37342531-37342553 CATGCCAAATACTCAGGAGGTGG + Intergenic
1083887532 11:65580179-65580201 GAAGCCAAAGTCAGTGAAGGTGG + Exonic
1083988765 11:66233803-66233825 CATGCCGAGGCCAGTGAAGGTGG + Exonic
1084896262 11:72272205-72272227 CATACCAAATACTGGCAAGGAGG - Intergenic
1086276057 11:85130440-85130462 CATGCCAAGGAAAGGGAAGGAGG + Intronic
1086922858 11:92606896-92606918 CCTGCCCAAGACAGTGAAGGTGG + Intronic
1087607883 11:100399090-100399112 CATGCCAAGCACTGTGGAAGAGG - Intergenic
1087701903 11:101444328-101444350 CATGCCAATGAGTCGGAAGGCGG + Intergenic
1088822015 11:113464460-113464482 AGTGCCAAAGACAGTGAGGGAGG - Intronic
1090484216 11:127098044-127098066 CATGACAAAGTCTGTGAAGAGGG - Intergenic
1091950387 12:4588002-4588024 CATGGCAAAAACTGTAAAGCTGG - Intronic
1092250724 12:6894501-6894523 CAGGCGAGAGAGTGTGAAGGAGG - Intronic
1092987064 12:13856066-13856088 AATGCCAAATTCTGTGAAGGTGG + Intronic
1093096393 12:14976496-14976518 CGAGCCAAAGACTGTCAGGGAGG + Intronic
1095099424 12:38165279-38165301 CTTGTCCAAGACTGTCAAGGTGG - Intergenic
1095359610 12:41320204-41320226 CAAGCCAAGGAATGTGAAGTGGG - Intronic
1097017175 12:55995620-55995642 AATTCCAAAGAATCTGAAGGTGG + Exonic
1097734018 12:63162351-63162373 CATGCCAAAGAAACTGAAGGAGG + Intergenic
1100957478 12:99925065-99925087 CATGACAAAGAGTGCGAGGGTGG + Intronic
1103140578 12:118544614-118544636 AATGCCAAAGACTGAGAATGGGG - Intergenic
1106473093 13:30075551-30075573 CATGCCAAAGGCTGAGAAACAGG + Intergenic
1109096726 13:58128258-58128280 CCTGTCAAAGCCTGTCAAGGGGG - Intergenic
1111123083 13:83879594-83879616 CATGCCCACCACGGTGAAGGCGG + Exonic
1111268322 13:85849452-85849474 CATGGGAAGGACTGTGTAGGAGG - Intergenic
1111456031 13:88485562-88485584 AAAGGCAAAGACTCTGAAGGAGG + Intergenic
1112464816 13:99634844-99634866 CGTGACAAAGGCTGTGAAGGAGG + Intronic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1112749400 13:102566671-102566693 AATGCCAAGTACTGTGAAGTAGG - Intergenic
1115738499 14:36361546-36361568 CATGCCAATAACTGGGAATGTGG - Intergenic
1119449934 14:74700923-74700945 AATGTGAAAGACTCTGAAGGGGG + Intronic
1121884262 14:97528599-97528621 GATGCCAAATACTGTATAGGAGG + Intergenic
1121927732 14:97944250-97944272 CATGCTATAGACTGTGAAAGTGG + Intronic
1125995241 15:44153596-44153618 GATGAAAAAGACTGTGGAGGTGG + Intronic
1126269085 15:46791671-46791693 CATACCAAAGACTGTGAGAATGG + Intergenic
1126657099 15:50990479-50990501 CATGCCTCAGACTTTGAATGTGG + Intronic
1126746462 15:51830216-51830238 CAAGCCGAAGCCTTTGAAGGAGG - Intronic
1126813108 15:52428604-52428626 TATGGCAAGGACTGTGAAAGAGG + Intronic
1127790552 15:62394762-62394784 CAAGCCAAAGATTGTCAGGGTGG - Intronic
1129749737 15:78053437-78053459 CATTGCAAAGACTGTGGAGATGG - Intronic
1130330706 15:82920192-82920214 AATGGCGAAGACTATGAAGGAGG - Intronic
1130879303 15:88041456-88041478 CATTCCAAAGAAAGTGATGGGGG - Intronic
1130945030 15:88544644-88544666 CACGCCAATGGCTCTGAAGGTGG + Intronic
1132341013 15:101078705-101078727 CATCCCAAAGACAGCCAAGGAGG - Intergenic
1132505865 16:308397-308419 CATGCCACAGACTCTGGATGAGG - Intronic
1133978710 16:10618338-10618360 CATGCCAGACACTGTGCTGGAGG + Intergenic
1135330693 16:21557439-21557461 CATGCCAGGGACTGTTAGGGAGG - Intergenic
1139267952 16:65657225-65657247 CATCCCCAGGCCTGTGAAGGAGG - Intergenic
1140626782 16:76803942-76803964 CAGGCAAGAGACAGTGAAGGGGG - Intergenic
1140782604 16:78310310-78310332 CATGCCAAACACTGGCCAGGAGG - Intronic
1141016658 16:80457223-80457245 AATGCCAAAGACTATGACAGCGG - Intergenic
1141760329 16:86024945-86024967 TATGGCAGAAACTGTGAAGGTGG + Intergenic
1142043723 16:87911919-87911941 CGTGCCAGGGACTGTGAGGGAGG - Intronic
1145007556 17:19346148-19346170 CATGCCACAGGCTGTCAGGGAGG - Intronic
1145778909 17:27549205-27549227 CCTGTAAGAGACTGTGAAGGTGG + Intronic
1146179307 17:30687106-30687128 AAGGAAAAAGACTGTGAAGGAGG - Intergenic
1147558985 17:41497475-41497497 CATGCCAATGATTGTGAATGAGG - Intergenic
1150445953 17:65227149-65227171 TTTGCCAAAGACTGTGGTGGGGG - Intronic
1150645677 17:66976227-66976249 CAAGCCAAAGACTGTCCAGATGG - Intronic
1151337176 17:73446847-73446869 CATTCCCAAGACAGAGAAGGAGG - Intronic
1153251068 18:3122218-3122240 AATGACAAAGACTGTCAGGGAGG + Intronic
1153492586 18:5664608-5664630 CATGACAATGACTGAGATGGAGG - Intergenic
1155772121 18:29714655-29714677 CATGTTACAGACTGTGAAGTGGG - Intergenic
1157231820 18:45924308-45924330 CAAGCCAGAGAATGTGAAGGTGG + Intronic
1158285649 18:55878608-55878630 ACTGCTAAAGACTGGGAAGGGGG + Intergenic
1158693858 18:59685620-59685642 CATGCCAGAAACTCTGGAGGTGG - Intronic
1158881320 18:61782143-61782165 CATGCCAAAGTGTGGGGAGGGGG - Intergenic
1162979318 19:14228463-14228485 AAGGAAAAAGACTGTGAAGGAGG + Intergenic
1163089740 19:15011377-15011399 CAGGCCCAAGTCTGAGAAGGTGG + Exonic
1164219589 19:23181469-23181491 GATGCCAATGGCTCTGAAGGTGG - Intergenic
1164792203 19:30996876-30996898 CATGCAAAATACAGTGAATGGGG - Intergenic
1164988490 19:32667060-32667082 CATGTCACAGATAGTGAAGGTGG - Intronic
1165522488 19:36325689-36325711 GATGCCAACGGCTCTGAAGGTGG - Intergenic
1168629916 19:57948549-57948571 CATGACAAAGAGGATGAAGGTGG + Intergenic
926692548 2:15747665-15747687 CAAGCCAAAGACAGAGCAGGAGG - Intergenic
927121714 2:19970592-19970614 CATGCTAAAGAATGTGATGGTGG - Intronic
927324009 2:21782030-21782052 CATGGAAAAGACTGGGATGGAGG + Intergenic
929434925 2:41921252-41921274 CCTGCCAGAGACAGTGAAGCAGG + Intergenic
934945060 2:98534825-98534847 TATGACAGAGACTTTGAAGGTGG + Intronic
939540415 2:143486656-143486678 CATGCTAAAGGCTGTGAATTCGG - Intronic
941739603 2:169019708-169019730 CATCCTAAACACTGTGAAAGGGG + Intronic
945214460 2:207418628-207418650 CATGTTAAAGACTGTGAACTTGG - Intergenic
945739637 2:213644604-213644626 CTTGTCCAAGACTGTGAAGGAGG - Intronic
948097594 2:235348805-235348827 CATGCCAAATACTGTGTTGAGGG + Intergenic
1169183577 20:3592644-3592666 CATGCCAAAGAGTTTGGAGTTGG - Intronic
1169959263 20:11140677-11140699 CTTGCCAAGGGCTGGGAAGGAGG + Intergenic
1170786603 20:19472823-19472845 CATGCCCAAGGGTGTGAACGTGG - Intronic
1172857492 20:38017074-38017096 CATGCCAAATACTGTCATAGAGG - Intronic
1175419996 20:58825615-58825637 TATGGCAAAAACCGTGAAGGTGG + Intergenic
1177880765 21:26690964-26690986 CATGCTGAAGAGTGTGAAGCAGG - Intergenic
1178671254 21:34593645-34593667 CCTGCCAGAGACTGAGAAGCTGG + Intronic
1183493880 22:38131073-38131095 TATGCCAAAAACTGTGAAGATGG + Intronic
1184281353 22:43439404-43439426 AATGGCAAAGAATGTGCAGGTGG + Intronic
1185011371 22:48316492-48316514 GAGGCCAAAGTCTGAGAAGGAGG + Intergenic
1185076449 22:48685780-48685802 CATGCAAAGGACTCTGAATGGGG - Intronic
1185252020 22:49807560-49807582 CATGCAAAAGAATGTGAAGTTGG + Intronic
949112395 3:277743-277765 CATGCCAAAGACAGGGAAAGGGG - Intronic
949261279 3:2105517-2105539 CAGGCAAGAGACAGTGAAGGAGG + Intronic
949935592 3:9113268-9113290 CCTTCCAAGGACTGTGAAGGAGG + Intronic
950460417 3:13118637-13118659 CTTGCCAAAGGCTGGGGAGGAGG + Intergenic
953273833 3:41475319-41475341 GATACCAGAGACTGAGAAGGTGG + Intronic
953851432 3:46468215-46468237 CATGCCAAAGCCTGTGTACATGG + Intronic
954491589 3:50912204-50912226 CGTGTCAAAGACTATCAAGGTGG - Intronic
955044570 3:55347730-55347752 CATGCCAAGGACTGGGCAGTGGG - Intergenic
955520603 3:59772070-59772092 CAAGCCAGTGACTGTGGAGGGGG - Intronic
955807312 3:62750439-62750461 AATGGCAAAGATTATGAAGGTGG + Intronic
956401477 3:68884336-68884358 CCTGCCAAAGACAGAGAAGGCGG - Intronic
959811510 3:110625636-110625658 CATACCAAAGACTGAGCAGCTGG + Intergenic
959961059 3:112298562-112298584 TATGCTAAATACTGTAAAGGTGG - Intergenic
961281443 3:125767854-125767876 CAACCCCAAGACTGTGCAGGGGG - Intergenic
965462655 3:168986915-168986937 GATGCCAAAGACTGCGAAAAGGG - Intergenic
966826271 3:183967514-183967536 CAGGCAGAAGGCTGTGAAGGGGG + Intronic
967329728 3:188278369-188278391 TCTGCCAAAGACTATGTAGGTGG + Intronic
967533442 3:190575552-190575574 CATGCCACTGCCTTTGAAGGTGG - Intronic
968604089 4:1523439-1523461 CACGTCAAAGACTGTGGACGTGG + Intergenic
970638739 4:18039664-18039686 GAGGCCAAAGTCTGTGAAGTGGG + Intergenic
970667349 4:18353335-18353357 CATGTCCAAGACCATGAAGGTGG - Intergenic
976382264 4:84413038-84413060 CTTGCCCAAGACTATGCAGGTGG - Intergenic
978837466 4:113169582-113169604 TAAGCCAGAGACTGTGACGGGGG + Intronic
980269336 4:130563824-130563846 CATCCCATAGACTGTGCAGCAGG + Intergenic
980968579 4:139547488-139547510 TATTCCAAAGACTGTGTATGTGG - Intronic
982195348 4:152906365-152906387 AATGGCAAAGACTGTGAGAGGGG - Intronic
983526686 4:168767249-168767271 CATGCCACAGACTGTGCCTGTGG + Intronic
983542205 4:168923751-168923773 CATGCCATAGAATTTAAAGGGGG - Intronic
987220159 5:15783124-15783146 CATGAGAACGACTGTGATGGTGG + Intronic
987456812 5:18157632-18157654 TATACTAAAGACTGAGAAGGGGG + Intergenic
988903487 5:35759972-35759994 CATCCCACAGACTCTGCAGGTGG + Intronic
989970630 5:50520667-50520689 CTTGTCCAAGACTGTCAAGGCGG - Intergenic
992109549 5:73479940-73479962 TATGCCAAAAATTGTGAAGATGG - Intergenic
993401794 5:87462366-87462388 GATACCAGAGACTGTGAAGTGGG - Intergenic
994081008 5:95709054-95709076 GATGCCAACGGCTCTGAAGGCGG - Intergenic
994235490 5:97357865-97357887 CTTGCCCAAGACTATCAAGGTGG - Intergenic
994475065 5:100257182-100257204 CCAACCAAAGACTGGGAAGGTGG - Intergenic
994657164 5:102608243-102608265 CATTGCTAAGACTGTCAAGGGGG - Intergenic
995029824 5:107467588-107467610 CATGGCAAAAGTTGTGAAGGTGG + Intronic
996411096 5:123160105-123160127 CATGCAAATGACTATGTAGGAGG - Intronic
998823940 5:146082339-146082361 TATGGCAAACATTGTGAAGGTGG - Intergenic
1005456574 6:26025458-26025480 AATGCCAAAGCCTGTGATAGTGG - Intergenic
1005738238 6:28768729-28768751 CATGCCAACAGCTCTGAAGGTGG - Intergenic
1005794065 6:29338794-29338816 CAAACAAAAGACTATGAAGGTGG + Intergenic
1007941568 6:45786275-45786297 CTTGCCAAAGTCTATGAATGGGG - Intergenic
1008310555 6:49966551-49966573 CATGGTAAAGTCTGTGAATGCGG + Intergenic
1010351427 6:74879626-74879648 CATGCCAAAAACTGTGGAATAGG + Intergenic
1010532255 6:76982949-76982971 CATGCATAAGAATGTGGAGGAGG + Intergenic
1012543768 6:100393648-100393670 CATACCCAGGCCTGTGAAGGAGG - Exonic
1013752136 6:113419597-113419619 TATGCCAAAAATTGTGAAGATGG + Intergenic
1016139305 6:140587937-140587959 CAGGAAAAAGAGTGTGAAGGAGG + Intergenic
1017051756 6:150399962-150399984 CATGCCAAACCCTATGAAGTAGG - Exonic
1017279247 6:152606070-152606092 CAAGCCACAGACTGTGAACATGG - Intronic
1018361630 6:163076546-163076568 CATGCCAAAGAATTTAAAGTAGG - Intronic
1020834108 7:13127126-13127148 CAACCCACAGACTGTGAATGAGG - Intergenic
1020897247 7:13955955-13955977 CATTTTAAAGACTGTGCAGGTGG - Intronic
1022061239 7:26797441-26797463 CTTGTCCAAGACTGTCAAGGTGG + Intronic
1022358599 7:29638929-29638951 CATGCCAATGACTCTAAAGGTGG - Intergenic
1022484860 7:30770684-30770706 AGTGGCAAAGATTGTGAAGGTGG + Intronic
1024239576 7:47423960-47423982 CATGCCAAAGACTGTGAAGGTGG - Intronic
1030022507 7:105289797-105289819 CATGTCAGAGGCTGAGAAGGAGG - Intronic
1033500798 7:141946932-141946954 CAAGGCAGAGACTGTGAAGAAGG - Exonic
1038071306 8:24017103-24017125 CATGCCAGAAACTGTGGAGATGG + Intergenic
1040294481 8:46142148-46142170 AATGCCAAAGACTTTGGAGCAGG - Intergenic
1041933764 8:63314805-63314827 TATGCCAAAGACCTGGAAGGAGG + Intergenic
1043162363 8:76861933-76861955 CATGACAAGGACTGTGATGGAGG - Intronic
1044474988 8:92615494-92615516 CATGGCAAAGACTGTGCATCAGG - Intergenic
1044480972 8:92687632-92687654 CATGAAAGAGAGTGTGAAGGGGG - Intergenic
1045918834 8:107506145-107506167 CATGGCAAATACCATGAAGGTGG - Intergenic
1045920731 8:107525693-107525715 CATGCCAAAGACACACAAGGAGG - Intergenic
1047823180 8:128543782-128543804 AAGACCAAAGACTTTGAAGGAGG - Intergenic
1049930626 9:453131-453153 CTCGCAAAAGCCTGTGAAGGAGG - Intronic
1055141893 9:72885814-72885836 TCTGCCACAGACTGTGAAGTAGG + Intergenic
1055241556 9:74192404-74192426 CATGCCCAAGAGAGAGAAGGGGG + Intergenic
1055730447 9:79275062-79275084 CACACCACATACTGTGAAGGGGG + Intergenic
1056831802 9:89923315-89923337 GATGCCAAAGGCTGTCCAGGAGG + Intergenic
1058896365 9:109404108-109404130 CATGCCAGAAACTGAGGAGGAGG - Intronic
1059614480 9:115933720-115933742 CTTCCCAAAGACAGTGAAGCTGG + Intergenic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1062686497 9:137816258-137816280 CATGCCGAAGTCTGTGCTGGGGG - Intronic
1186418151 X:9401233-9401255 CAAGCCAAAGACTGGGCAGATGG + Intergenic
1187244600 X:17542513-17542535 AATGCCAAAGACATTGAAGGGGG + Intronic
1188755784 X:33961031-33961053 CATGTGAAAGACTGGGATGGAGG + Intergenic
1189259847 X:39670532-39670554 CAAGCCAAAGCATGGGAAGGTGG + Intergenic
1192196245 X:69030343-69030365 CATGACAAGGACTGTTAAGTGGG - Intergenic
1193575353 X:83188556-83188578 TATTCCAAAAACTGAGAAGGAGG - Intergenic
1193850269 X:86529422-86529444 AATACCAAAGACTGGGAATGGGG - Intronic
1196232542 X:113240549-113240571 TAGGCCCAAGACAGTGAAGGGGG - Intergenic
1197755721 X:129992924-129992946 CCTGCCATAGACTGTGACAGTGG - Intronic
1198733509 X:139760322-139760344 CAGGCCAAACACTGTGGAGGAGG - Intronic
1199076095 X:143529017-143529039 CATGTCCAAGACCGTCAAGGTGG - Intergenic
1201385590 Y:13436597-13436619 CATGCTAAAGAATTTCAAGGAGG + Intronic