ID: 1024240639

View in Genome Browser
Species Human (GRCh38)
Location 7:47432689-47432711
Sequence GCTGCTTCCACCCACAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024240639_1024240644 6 Left 1024240639 7:47432689-47432711 CCTGCATTGTGGGTGGAAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 220
Right 1024240644 7:47432718-47432740 TGTACGTGAACAGATGGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 125
1024240639_1024240642 0 Left 1024240639 7:47432689-47432711 CCTGCATTGTGGGTGGAAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 220
Right 1024240642 7:47432712-47432734 CATGGATGTACGTGAACAGATGG No data
1024240639_1024240643 3 Left 1024240639 7:47432689-47432711 CCTGCATTGTGGGTGGAAGCAGC 0: 1
1: 0
2: 0
3: 11
4: 220
Right 1024240643 7:47432715-47432737 GGATGTACGTGAACAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024240639 Original CRISPR GCTGCTTCCACCCACAATGC AGG (reversed) Intronic
900150323 1:1175994-1176016 GCTGCTCCCAGCCACTGTGCAGG + Intronic
900211455 1:1458228-1458250 GCTGCTGCCTCCCAAAATGCTGG + Intronic
900290570 1:1921927-1921949 CCTGCTGTCACCCACACTGCAGG + Intergenic
900678345 1:3902133-3902155 GCTGCGGCCTCCCAAAATGCTGG + Intergenic
900956137 1:5887511-5887533 GCTGCTTCCACCAGCCCTGCAGG + Intronic
901883726 1:12208578-12208600 CCTGCTTCCTCCCAGAATCCGGG - Exonic
904888060 1:33756630-33756652 CCTGCTTCTACCTACCATGCTGG - Intronic
905456093 1:38088829-38088851 CCTGCCTCCACCCTCCATGCAGG + Intergenic
906031024 1:42720226-42720248 GATGCTTCCACCCAGCATCCTGG + Intergenic
907706917 1:56840277-56840299 TCTGCTTCCACTTACAATGGTGG + Intergenic
907711400 1:56885797-56885819 GCTTCTGCCTCCCAAAATGCTGG + Intronic
908582929 1:65536319-65536341 GTTGCTTCCACTCATAGTGCAGG - Intronic
909967400 1:81931887-81931909 GCTTCTGCCTCCCAAAATGCTGG + Intronic
910402631 1:86852647-86852669 GCTGCTGCCTCCCAAAATGCTGG + Intergenic
911282302 1:95945118-95945140 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
915466284 1:156100128-156100150 CCTGCTTCCAGCCACACTGGTGG - Intronic
916577092 1:166077228-166077250 GCTGCTTTCAGCCATGATGCTGG - Intronic
921035810 1:211377023-211377045 GCTGCTCCCACCCAGACTGATGG - Intergenic
921675379 1:217969698-217969720 GCTCCTTCCACCCACTTGGCCGG - Intergenic
921731118 1:218579500-218579522 GCTGCCACCACCAGCAATGCAGG + Intergenic
922620871 1:226987327-226987349 GCTGCTCCCACCCTCACTGTGGG - Exonic
923006253 1:230052411-230052433 GCTGGTTCCACCCTCACTGCTGG + Intergenic
923545531 1:234920507-234920529 ACTTCTGCCACCCACAGTGCTGG - Intergenic
1062921586 10:1284476-1284498 GCTGCCTCCACCCACAGCACGGG + Intronic
1063963655 10:11328000-11328022 GCTGCTGCCTCCCCCAGTGCTGG + Intronic
1065714641 10:28554115-28554137 GCCTCTTCCTCCCACAGTGCTGG + Intronic
1065861300 10:29874446-29874468 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1068835190 10:61545216-61545238 GCTTCAGCCACCCACAGTGCTGG - Intergenic
1068863590 10:61871196-61871218 GCTTCTGCCTCCCACAGTGCTGG + Intergenic
1069029449 10:63579886-63579908 ACTGCTACCACCCTCACTGCAGG + Intronic
1069678002 10:70262906-70262928 GCTTCTTCCTCCCAAAGTGCTGG - Intronic
1069915170 10:71782815-71782837 GCAGCTTCCACCCCCCAGGCAGG + Intronic
1070173836 10:73953834-73953856 TATGCTTCCAACCACAGTGCTGG + Intergenic
1070355936 10:75640273-75640295 GCTGCTTCCCCCCATTAGGCAGG + Intronic
1070919398 10:80174804-80174826 GCTGCGGCCTCCCACAGTGCTGG + Intronic
1071230366 10:83579326-83579348 GCTGCCTCCCTCCACAAGGCTGG - Intergenic
1073786326 10:106894082-106894104 GCTGCTTCCACCCACCCCTCTGG - Intronic
1075017980 10:118924898-118924920 GCTGCCTGCACCAACAATGATGG + Intergenic
1075559480 10:123458109-123458131 GCTGCTTCCAAACCCAAGGCCGG + Intergenic
1076321970 10:129589784-129589806 GCTGCTTCCACCTCCAGGGCGGG + Intronic
1076978516 11:193061-193083 GCTGCCTCCAGCCAGAATCCCGG - Exonic
1077555028 11:3221874-3221896 GCTGCCTCCACCCCAGATGCCGG + Intergenic
1083098501 11:60278838-60278860 TCTGCCTCCACCCACAAGCCTGG + Intergenic
1088892859 11:114058792-114058814 ACTGTTTCCACCCAGATTGCTGG + Intergenic
1089048439 11:115524780-115524802 CCTGCTTCCAAGCACAGTGCTGG + Intergenic
1089610293 11:119664996-119665018 GCTGCTTCCACCCAGTGGGCCGG + Exonic
1091820883 12:3474412-3474434 GCTGCAGCCACCCAGCATGCGGG + Intronic
1092861013 12:12718704-12718726 ACTACCTCCACCCACAATCCTGG - Intronic
1097658262 12:62396359-62396381 GCTGTTTCCAACCACTATGGAGG + Exonic
1098853290 12:75623649-75623671 GCTGCCAACACCCACAATACTGG - Intergenic
1100610781 12:96190760-96190782 GCTGCGGCCTCCCAAAATGCTGG + Intergenic
1101142021 12:101805643-101805665 GCTTCTGCCTCCCAAAATGCTGG + Intronic
1101448127 12:104752776-104752798 GCTGCTGCCTCCCAAAGTGCTGG + Intronic
1104103534 12:125637645-125637667 GTTGCTTTCAGCCACAATGATGG - Intronic
1104434405 12:128744092-128744114 ACCACTTCCCCCCACAATGCTGG - Intergenic
1105002890 12:132702665-132702687 ACTGTTTGCACCAACAATGCAGG - Intronic
1105448867 13:20480726-20480748 GCTGCGGGGACCCACAATGCTGG + Intronic
1105891045 13:24682467-24682489 ACTGCCTCCAACCAGAATGCAGG - Intronic
1105900939 13:24752669-24752691 GCGGCTTCCATCCACAGTGCAGG - Intergenic
1106514296 13:30439783-30439805 GCTGCTTCCAACTACTATGGTGG + Intergenic
1107247629 13:38316242-38316264 GCTTCTTCCATCCTCAATCCAGG + Intergenic
1109920865 13:69056578-69056600 GCTGCTGCCTCCCAAAGTGCTGG - Intergenic
1112398049 13:99051311-99051333 TCTGCTTGAGCCCACAATGCAGG + Intronic
1114707173 14:24738802-24738824 CCTGGTCCCTCCCACAATGCTGG + Intergenic
1119836072 14:77749949-77749971 GCTTCTGCCACCCAAAGTGCTGG - Intronic
1119931310 14:78550277-78550299 GCTTCTGCCTCCCACAGTGCTGG + Intronic
1121357295 14:93226396-93226418 CCCGCTTCCTCCCAGAATGCTGG - Intronic
1123692141 15:22847153-22847175 GCTTCTTCCTCCCAAAGTGCTGG + Intronic
1123892717 15:24797467-24797489 GCTTCGGCCTCCCACAATGCTGG + Intergenic
1125259458 15:37806375-37806397 GCTGCTTCCAAACATAATGGAGG + Intergenic
1129613280 15:77078436-77078458 GCTGCGGCCTCCCAAAATGCTGG - Intronic
1131029402 15:89173880-89173902 GCTGCTTCCTCCCAAACAGCAGG - Intronic
1131106467 15:89738058-89738080 ACTGCGTCCACCGACGATGCTGG + Exonic
1133030574 16:3008922-3008944 GCAGCCTCCACCCACTCTGCTGG + Intergenic
1134297961 16:12963273-12963295 TCTCCTTCCACCCCCAATACTGG - Intronic
1135117318 16:19734830-19734852 CCTGCTTCCACACACAAAGCAGG - Intronic
1135310020 16:21398217-21398239 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1135362913 16:21830328-21830350 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1135374456 16:21933817-21933839 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1135425220 16:22329357-22329379 GCTGCTTCCACTCACATTTCTGG - Intronic
1135448878 16:22540730-22540752 CCTGCTTCCACCCAAAGTGGTGG + Intergenic
1136149601 16:28338561-28338583 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1136306765 16:29377360-29377382 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1137666432 16:50252226-50252248 CCTGCTTCCACCCACCCTCCAGG - Intronic
1139380066 16:66524950-66524972 GCTGCTTGCCCCCACACAGCAGG + Intronic
1140093572 16:71856343-71856365 GCTGCTGCCACACACACTGCAGG - Exonic
1141394926 16:83696138-83696160 GCTTCTGCCTCCCACAGTGCTGG + Intronic
1141468242 16:84221313-84221335 GCTGGTTGCTCCCACACTGCAGG - Exonic
1142465946 17:137552-137574 GCTGCCTCCAGCCAGAATCCCGG - Exonic
1142839126 17:2613449-2613471 GCTGCAGCCACCAACACTGCGGG - Intronic
1143849245 17:9797252-9797274 ACTGCATCCTCCCAAAATGCTGG + Intronic
1144747883 17:17627752-17627774 GCTGCGGCCTCCCAAAATGCTGG + Intergenic
1146005526 17:29158418-29158440 GCTGCTGCCAAACACCATGCGGG + Intronic
1147766603 17:42840800-42840822 GGTGCTGCCACCCTGAATGCAGG + Intronic
1148069346 17:44898981-44899003 GCCGCTTCCCGCTACAATGCAGG + Intronic
1148805277 17:50260794-50260816 GCTGCCTCCACGGACAGTGCAGG + Intergenic
1149698648 17:58636975-58636997 GCTTCTGCCTCCCAAAATGCTGG - Intronic
1151740132 17:75975692-75975714 GCCCCTTCCTCCCAAAATGCTGG - Intronic
1151853169 17:76703370-76703392 GCCGCTGCCTCCCAAAATGCTGG - Intronic
1152058200 17:78049324-78049346 GGTGCTTCCAACTCCAATGCTGG + Exonic
1152647850 17:81477976-81477998 GCTGCTCCCACCCGCAGTGTGGG - Intergenic
1154040818 18:10854029-10854051 GCTGCCTCCACTCTCTATGCAGG + Intronic
1154116319 18:11615339-11615361 CCTGCTTCCACCCAAAGTGGTGG - Intergenic
1156005995 18:32441956-32441978 GCTGCTTCCATCCATAATCAAGG + Intronic
1157638915 18:49192169-49192191 GATCCTTCCACCCAGAGTGCTGG + Intronic
1157733254 18:50022962-50022984 GTTGCCTCCTCCAACAATGCTGG - Intronic
1159406117 18:68005058-68005080 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1159985140 18:74832984-74833006 ACTGCTTCCACCTACACTGGTGG + Intronic
1160820254 19:1054525-1054547 GCTGCTTCCATCCACCCTCCAGG - Intronic
1162157434 19:8688329-8688351 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1162660336 19:12163499-12163521 GCTCCTTCCACGCACAAGTCAGG - Intronic
1163854010 19:19685273-19685295 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1164619893 19:29688786-29688808 GCTTCTGCCACCCAAAATACTGG + Intergenic
1164980208 19:32607915-32607937 ACAGCTCCCACACACAATGCGGG + Intronic
1166288932 19:41849300-41849322 GCTGTGTCCAACCACAGTGCTGG + Intronic
925154074 2:1637053-1637075 GCTGATTCTGTCCACAATGCTGG - Intronic
925297466 2:2787378-2787400 GCTGTGTACACCCACCATGCAGG - Intergenic
925483294 2:4300784-4300806 GCTGTTTCCAGCAAAAATGCAGG - Intergenic
927168139 2:20345622-20345644 GCTTCATCCTCCCAAAATGCTGG - Intronic
929003519 2:37371740-37371762 GCTTCTTCCACACAGATTGCTGG + Intronic
929672018 2:43883649-43883671 GCTGATTCCAAGCACAGTGCAGG - Intergenic
930790093 2:55316464-55316486 GCTTCTACCTCCCAAAATGCTGG - Intronic
931638101 2:64358806-64358828 GCTGCCTCCTCCAACAAGGCAGG + Intergenic
931941407 2:67255556-67255578 GATGCTTCAAACCACAAAGCTGG - Intergenic
932028186 2:68156985-68157007 GCCTCTTCCAACCACACTGCAGG + Intronic
932194788 2:69774070-69774092 GCCCCTGCCTCCCACAATGCTGG + Intronic
933251530 2:80034601-80034623 GCTTCTGCCTCCCACAGTGCTGG + Intronic
933291285 2:80441150-80441172 TCTCCTTCCACCCACCATGTAGG - Intronic
933971768 2:87475542-87475564 GCTGCTGCCTCCCACAAGCCAGG - Intergenic
934959569 2:98659057-98659079 GATGCTTCTACCCTCCATGCTGG - Intronic
935221120 2:101013902-101013924 GCTGTTTCCAACCACTATGGAGG - Intronic
935394103 2:102587415-102587437 GATTCTTCTACCCACAATGAAGG - Intergenic
936321960 2:111474659-111474681 GCTGCTGCCTCCCACAAGCCAGG + Intergenic
937203127 2:120218545-120218567 GCTGCTTCTACCTACATGGCTGG + Intergenic
941306657 2:163877514-163877536 GGTGCTTCCAGCCACAAAGCTGG - Intergenic
945843320 2:214914116-214914138 GCCTCTGCCACCCACAGTGCTGG + Intergenic
1168897948 20:1336830-1336852 GCTGCTTCCGGCCAGGATGCAGG - Intronic
1170207661 20:13816503-13816525 GCTGCATCGAGACACAATGCTGG + Exonic
1171212102 20:23324998-23325020 GCTGCTGCCACCCAAAAGGTAGG - Intergenic
1174259586 20:49284176-49284198 GCTGCTTCCATCCAGAATGAGGG + Intergenic
1174530410 20:51208299-51208321 GCTGGTTCCACCGGCAGTGCTGG - Intergenic
1175287539 20:57847192-57847214 GCTGCTTCCACTCATGATGGAGG + Intergenic
1175545148 20:59773257-59773279 GCTGCTTCCTCCCACACCCCAGG + Exonic
1176155449 20:63617823-63617845 GCTGCTTCCACCCAGACGCCTGG + Intronic
1176246726 20:64100963-64100985 GCTGCTCCCACCCAGGTTGCAGG + Intergenic
1178396807 21:32250115-32250137 GCTGGTGACACCCACACTGCTGG - Intergenic
1178408159 21:32342353-32342375 GCTGCTGCCTCCCACCAGGCTGG + Intronic
1179731914 21:43372824-43372846 GGGGCTTACACCCACAGTGCGGG + Intergenic
1179731923 21:43372871-43372893 GGGGCTTACACCCACAGTGCGGG + Intergenic
1180905752 22:19409931-19409953 GATGCTTCCACCCAGAATCAAGG - Intronic
1181098052 22:20519702-20519724 GCCGCATCCTCCCACAGTGCTGG + Intronic
1182681406 22:32082745-32082767 GCGTCTTCCACACACAAGGCAGG - Intronic
1184294827 22:43516655-43516677 GCTGCTTCCAGCCACGGTGGGGG + Intergenic
1184483007 22:44759093-44759115 CCTGGTTCCACCCACACTCCAGG - Intronic
1185428092 22:50784916-50784938 GTTGCTTCCATCCAGAAAGCTGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954946338 3:54427877-54427899 GCTCCTTGCTGCCACAATGCTGG - Intronic
955510507 3:59676071-59676093 GCTGCTTCCACTGAAACTGCAGG - Intergenic
958082617 3:88766520-88766542 GCTGCGGCCTCCCAAAATGCTGG - Intergenic
960587426 3:119333166-119333188 CCTGGTTCAACCCAGAATGCTGG - Intronic
962160200 3:132990786-132990808 GCTGCATCCATGCACTATGCTGG - Intergenic
962548642 3:136465468-136465490 GCTACATCCTCCCAAAATGCTGG + Intronic
962566644 3:136667296-136667318 GCCTCTGCCACCCAGAATGCTGG - Intronic
962710552 3:138082116-138082138 GAGGCTCCCTCCCACAATGCGGG + Intronic
963611537 3:147474939-147474961 GCTTCGGCCACCCAAAATGCTGG - Intronic
963851065 3:150210910-150210932 GCCGCTGCCACCCAAAATGAGGG - Intergenic
968278633 3:197459284-197459306 GCGCCTTCCACCAACAGTGCTGG + Intergenic
968973837 4:3810916-3810938 GCTGCCTCCACTCACAGTGGAGG + Intergenic
969162601 4:5274652-5274674 GCTGCTGCCAGCTCCAATGCCGG - Intronic
970029731 4:11661009-11661031 GCTTCGTCCACCCAAAGTGCTGG + Intergenic
972508715 4:39746642-39746664 ACCACTTCCACCCACAATGTGGG + Intronic
976266995 4:83194129-83194151 GCTTCTGCCTCCCAAAATGCTGG - Intergenic
976593405 4:86871654-86871676 GCTTCTGCCTCCCAAAATGCTGG - Intergenic
979251124 4:118567586-118567608 GATCCTTCCACCCAAAGTGCTGG - Intergenic
980722883 4:136720474-136720496 GCGGCTTGCACCCACGAAGCAGG - Intergenic
985689610 5:1299804-1299826 GCTGCTTTCAGCCACCAGGCTGG - Intergenic
985953769 5:3244534-3244556 GCTGCTTCCACTCACCAGGAAGG + Intergenic
986720240 5:10555934-10555956 GCTGTGTCCTCCCACAGTGCTGG - Intergenic
986754587 5:10823825-10823847 CCTGCTACCACTCCCAATGCCGG - Intergenic
987110127 5:14678194-14678216 GCTGCTCCCTCCCTCCATGCAGG - Intronic
987328081 5:16830462-16830484 GTTGCTTATACCCACTATGCAGG + Intronic
988512023 5:31872582-31872604 GCTCCTTCCTCCCCCAAGGCAGG + Intronic
991650665 5:68849164-68849186 TCTTCTCCAACCCACAATGCAGG + Intergenic
995203405 5:109451377-109451399 GCTGCTGCCACCAACACTGAGGG - Intergenic
995476706 5:112555384-112555406 GCTGAGTCCAGCCACAGTGCTGG - Intergenic
995845302 5:116487612-116487634 GCTGCAGCCTCCCAAAATGCTGG - Intronic
998411370 5:141914169-141914191 GCTGCTTTCCCCCTCAAGGCTGG + Intergenic
1001946110 5:175779382-175779404 ACTGCTTCAACCCACACAGCTGG - Intergenic
1005460943 6:26069958-26069980 GCTGCTGCCACCAACAAGTCAGG - Intergenic
1005694494 6:28338570-28338592 GCTTCTGCCTCCCAAAATGCTGG + Intronic
1006496319 6:34425947-34425969 GCTGCTTCTCCCCAGGATGCGGG - Exonic
1008384513 6:50873152-50873174 GCTGCTTCTGTCAACAATGCAGG + Intergenic
1010823436 6:80443756-80443778 GCTGCATACTCCCAAAATGCTGG + Intergenic
1015561128 6:134517274-134517296 GCTGCGTCCTCTCTCAATGCAGG - Intergenic
1015622190 6:135142683-135142705 GCCTCTGCCACCCAAAATGCTGG + Intergenic
1022882591 7:34603907-34603929 GCTGCTACCACACAAAATACTGG - Intergenic
1023002840 7:35829213-35829235 GCAGCTTCCACCCCCTAGGCAGG + Intronic
1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG + Intronic
1023821372 7:43982502-43982524 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1024240244 7:47429287-47429309 GCTGCTTTCACTCTCACTGCAGG + Intronic
1024240639 7:47432689-47432711 GCTGCTTCCACCCACAATGCAGG - Intronic
1024677562 7:51650747-51650769 GCTGCTTCCACTCATGATGGAGG - Intergenic
1027385140 7:77652569-77652591 GCTTCATCCTCCCAAAATGCTGG + Intergenic
1028455823 7:91036928-91036950 CCTGCTCCCACCCACACTGAAGG + Intronic
1029077356 7:97945820-97945842 GCTTCTGCCTCCCAAAATGCTGG - Intergenic
1029749634 7:102535924-102535946 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1029767584 7:102635028-102635050 GCTTCTGCCTCCCAAAATGCTGG + Intronic
1030299074 7:107957138-107957160 GCTGCAGCCTCCCAAAATGCTGG - Intronic
1032010973 7:128347747-128347769 GCAGCAGCCACCCACAGTGCAGG + Intergenic
1032977941 7:137247162-137247184 GCAGCTTCCACCCAAAATAAAGG + Intronic
1033915004 7:146313747-146313769 GCCTCTGCCTCCCACAATGCTGG - Intronic
1034133682 7:148744758-148744780 TTTGCTTCCACCCAAAATGCAGG + Intronic
1034679652 7:152918984-152919006 GCTGCCTCCACCCCCACTCCGGG - Intergenic
1037826661 8:22164342-22164364 GCTGCTTCTGCCCACACCGCAGG + Exonic
1037982606 8:23265158-23265180 GCTTCTGCCTCCCAAAATGCTGG - Intergenic
1039171868 8:34756783-34756805 GCTGCTTCCACTCAAAAGGGAGG + Intergenic
1040007048 8:42629530-42629552 GCTGCTCCCTACCACAAAGCAGG - Intergenic
1040365765 8:46713398-46713420 GCTTCTGCCTCCCAAAATGCTGG + Intergenic
1041993025 8:64017291-64017313 GCTGCCTCCACCCTCAGTTCTGG + Intergenic
1045573220 8:103391388-103391410 ACTGCGTCCACCCACACTGAGGG + Intergenic
1048084981 8:131167578-131167600 GCTGCTTGGACCCACAAGGGAGG + Intergenic
1048638526 8:136326601-136326623 GCTCCTTCCAACCACATGGCGGG + Intergenic
1049997213 9:1044873-1044895 GCAGCTTCCATCCTCCATGCTGG - Intergenic
1059096591 9:111422659-111422681 GCTGCTTCCACGCCCAGTGCAGG - Intronic
1061092736 9:128435717-128435739 GCTGCCCCTACCCACTATGCCGG + Exonic
1061413683 9:130434030-130434052 GCTGCTGCCACCCCTAACGCGGG - Exonic
1061617804 9:131791823-131791845 GGACCTTCCAACCACAATGCAGG + Intergenic
1061676187 9:132217087-132217109 GCTTCTTCCACCCACAGCCCTGG + Intronic
1186413121 X:9361017-9361039 GCCCCTTCCACCCACAATCAAGG + Intergenic
1186927918 X:14355708-14355730 GATAATTCCACCCACAAAGCAGG + Intergenic
1199559786 X:149150689-149150711 GCTCCTTTCCCCCTCAATGCTGG + Intergenic
1201347113 Y:12997035-12997057 GCTGCTTCCACAAACAACACAGG - Intergenic