ID: 1024242484

View in Genome Browser
Species Human (GRCh38)
Location 7:47446364-47446386
Sequence CCCAAGCTGTGGTTTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242479_1024242484 1 Left 1024242479 7:47446340-47446362 CCTGCTCACGTCCTCAGAAGCCT 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1024242484 7:47446364-47446386 CCCAAGCTGTGGTTTCCTTGTGG 0: 1
1: 0
2: 4
3: 18
4: 204
1024242480_1024242484 -10 Left 1024242480 7:47446351-47446373 CCTCAGAAGCCTTCCCAAGCTGT 0: 1
1: 0
2: 2
3: 22
4: 264
Right 1024242484 7:47446364-47446386 CCCAAGCTGTGGTTTCCTTGTGG 0: 1
1: 0
2: 4
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242484 Original CRISPR CCCAAGCTGTGGTTTCCTTG TGG Intronic