ID: 1024242787

View in Genome Browser
Species Human (GRCh38)
Location 7:47448277-47448299
Sequence GTTTTGTTGCAGAGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242787_1024242800 25 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242800 7:47448325-47448347 GGAGACATGGGATCCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 145
1024242787_1024242802 29 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242802 7:47448329-47448351 ACATGGGATCCTCCCCAGGTGGG 0: 1
1: 0
2: 6
3: 12
4: 129
1024242787_1024242796 12 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242796 7:47448312-47448334 CACGACGTCCCAGGGAGACATGG No data
1024242787_1024242803 30 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242803 7:47448330-47448352 CATGGGATCCTCCCCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 191
1024242787_1024242794 4 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242794 7:47448304-47448326 TTGAAGTCCACGACGTCCCAGGG No data
1024242787_1024242801 28 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242801 7:47448328-47448350 GACATGGGATCCTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 129
1024242787_1024242797 13 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242797 7:47448313-47448335 ACGACGTCCCAGGGAGACATGGG No data
1024242787_1024242793 3 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242787 Original CRISPR GTTTTGTTGCAGAGGGAATG GGG (reversed) Intronic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
903284237 1:22267196-22267218 GCCCTGTTGCAGGGGGAATGGGG - Intergenic
904058597 1:27688485-27688507 GCTTTATTTCAGAGGGGATGGGG + Intergenic
904688926 1:32279479-32279501 GTTTTTTTGCAGAGGGGCTAGGG - Intronic
909736056 1:78963312-78963334 GTGTTGGGGCAAAGGGAATGTGG - Intronic
911281037 1:95929303-95929325 GTTTGTCTGCAGAGGGCATGAGG - Intergenic
911582900 1:99655550-99655572 GTTTTTTTGAAGAGGCAAAGAGG - Intronic
912044063 1:105432702-105432724 ATTTTTTTGCTGAAGGAATGTGG - Intergenic
912045701 1:105452919-105452941 ATTTTGTTTCATAGGGAATATGG - Intergenic
912299936 1:108504381-108504403 GTTATGTGGCAGGGGAAATGAGG - Intergenic
912400304 1:109385634-109385656 TGGTTGTAGCAGAGGGAATGGGG - Intronic
912800272 1:112715542-112715564 GTTCTGTTGCTGTGGGAAGGGGG + Intergenic
913424998 1:118718687-118718709 GTTTTTTTGCAGAGGGTAGGGGG - Intergenic
915849918 1:159310400-159310422 CTCTTGGTCCAGAGGGAATGTGG + Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918839865 1:189520978-189521000 GTTTTTATACAGAGGGACTGTGG - Intergenic
919734278 1:200935803-200935825 GTTTTGTTTCAGACGGAGTCTGG - Intergenic
919921301 1:202168094-202168116 GTTTTCTGGCAGAGGTAAGGTGG + Intergenic
920529920 1:206694371-206694393 CTTTCCTTGCAGAGGAAATGTGG - Intronic
920567371 1:206985568-206985590 GTGATGATGCAGATGGAATGTGG - Intergenic
920785030 1:209033180-209033202 GCTTGGGTGAAGAGGGAATGAGG + Intergenic
921997855 1:221441071-221441093 CTTTTGTTCCAGGGGGCATGGGG + Intergenic
924353873 1:243148881-243148903 CTTTTGTTGCATAAAGAATGGGG - Intronic
1063208457 10:3856770-3856792 GTTTGGTTGGAGAATGAATGAGG - Intergenic
1065918109 10:30368929-30368951 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1066679961 10:37928668-37928690 GTCTGGAGGCAGAGGGAATGAGG - Intergenic
1067936132 10:50613574-50613596 GTTTGCTTGGTGAGGGAATGTGG - Intronic
1072333476 10:94376046-94376068 GTGGTGTTGCACAGAGAATGGGG - Intergenic
1074406241 10:113182385-113182407 GACTTGTTGCAGAGGGAAAGTGG + Intergenic
1075219978 10:120576401-120576423 GGTTTGTTGCAGTGGTAATGAGG + Intronic
1077590671 11:3488634-3488656 GTTTTATTGCAAAGTGATTGAGG - Intergenic
1078331634 11:10427011-10427033 GTGGTGTTTCAGAGGGAATCGGG - Intronic
1078905130 11:15678345-15678367 GTTTTGTTGTCCAGGTAATGTGG - Intergenic
1079513899 11:21244056-21244078 GTTATGCTGTAGAAGGAATGAGG - Intronic
1080432479 11:32211578-32211600 GTTCTGTTGCTGGGGGAAAGAGG - Intergenic
1080469727 11:32533260-32533282 GTTATGTGGAAGTGGGAATGGGG + Intergenic
1080627200 11:34041328-34041350 TTCTTGTTGCAGAAGTAATGAGG + Intergenic
1084123844 11:67085711-67085733 GTGTTGTTGCAGAAGAAATGAGG - Intergenic
1084246389 11:67860416-67860438 GTTTTATTGCAAAGTGATTGAGG - Intergenic
1084648438 11:70474180-70474202 GTTTTGTTGCAGAAGGAGCTGGG + Intronic
1084826289 11:71734085-71734107 GTTTTATTGCAAAGTGATTGAGG + Intergenic
1084995607 11:72974425-72974447 GTATTGTTGCATTGGGAATTAGG + Intronic
1085557117 11:77434449-77434471 TTTTTTTTGGAGAGGGGATGGGG + Intronic
1085862127 11:80246500-80246522 GTTGTGTTGAAGATAGAATGAGG + Intergenic
1086742523 11:90385135-90385157 GTTTTCTTGCTGAGGGTAGGGGG + Intergenic
1087161046 11:94948416-94948438 GTTTTGAAGCAGAGGGAGGGAGG - Intergenic
1090411874 11:126514800-126514822 GTTGTGTTGGAGAGGCAATGTGG - Intronic
1091761143 12:3088134-3088156 GTTTTGTTTTAGAGAAAATGAGG + Intronic
1092416955 12:8297538-8297560 GTTTTATTGCAAAGTGATTGAGG - Intergenic
1093661573 12:21763574-21763596 GTTTAGTTGCAGCTGGAAGGTGG + Intergenic
1094060678 12:26312214-26312236 GTTTTGGGGCTGAGGCAATGGGG + Intergenic
1094480845 12:30880343-30880365 GTTTCCTTGCAGAGGCCATGAGG - Intergenic
1095092690 12:38121639-38121661 TTTTTTTTGCAGGGGGAGTGGGG - Intergenic
1096862831 12:54542296-54542318 GTTTTGCTGCACTGGGAAAGTGG + Intronic
1097909799 12:64957687-64957709 GGTTTGAACCAGAGGGAATGTGG + Intergenic
1098041973 12:66361799-66361821 AATCTGTTGCAGAGGGAATTGGG - Intronic
1098212292 12:68179279-68179301 GTTTTATTCTAGAGGAAATGGGG + Intergenic
1101377191 12:104181550-104181572 GATTTAATCCAGAGGGAATGAGG - Intergenic
1101428199 12:104605138-104605160 TTTTTTTTGGAGAGGGGATGGGG - Intronic
1102003733 12:109575148-109575170 GCTTTGATGCAGAAGGAAAGAGG + Intronic
1102447566 12:113015307-113015329 GTCATGTTCCTGAGGGAATGAGG + Intergenic
1104372028 12:128231917-128231939 GATTGGTAGCAGGGGGAATGGGG - Intergenic
1104469114 12:129014837-129014859 CTTTGGCTGCAGAGGGAATTTGG + Intergenic
1107858109 13:44635188-44635210 GGATTGATCCAGAGGGAATGAGG + Intergenic
1109280246 13:60348082-60348104 GCTTTGTTGTTGGGGGAATGTGG + Intergenic
1111040554 13:82741534-82741556 TTTTTGTTGCAGATGGATTGAGG - Intergenic
1112095508 13:96127945-96127967 ATTCTGTTGCAGTGGGTATGGGG - Intronic
1113199910 13:107855582-107855604 TTTTTGTTTTAGAGGGAAGGAGG - Intronic
1114050481 14:18916687-18916709 GGTTTGTTGCAGAGTGAGTTTGG - Intergenic
1114112076 14:19485245-19485267 GGTTTGTTGCAGAGTGAGTTTGG + Intergenic
1115305227 14:31927053-31927075 GTTTTGTTGCAGAGTATATGCGG + Intergenic
1115543704 14:34446159-34446181 GTTTTGTTGTAGTGTGGATGGGG - Intronic
1115957629 14:38798866-38798888 GTTTTGTTGGAGAGGGACTGGGG + Intergenic
1116354547 14:43912348-43912370 TTTTTGTTTCAGAGGGAACTTGG - Intergenic
1117541103 14:56747315-56747337 GTTTGGTAGAAGAGGGAACGAGG + Intergenic
1118877135 14:69795164-69795186 GCTTTGTAGCAGAGAGGATGTGG + Intronic
1119974778 14:79013374-79013396 GTTTTGGTGCACATAGAATGAGG - Intronic
1120209577 14:81621737-81621759 GTTTGGCTGCAGAGGAAATGAGG + Intergenic
1121605273 14:95235962-95235984 GCTTGGTGGCAGAGGGAAGGTGG - Intronic
1123472983 15:20568544-20568566 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1123645023 15:22431809-22431831 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1123666314 15:22611585-22611607 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1123733284 15:23163535-23163557 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1123751418 15:23360910-23360932 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1124283788 15:28384828-28384850 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1124298909 15:28526785-28526807 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1124959378 15:34383324-34383346 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1124976004 15:34529545-34529567 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1127773240 15:62246910-62246932 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1127774555 15:62254922-62254944 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1128903167 15:71443746-71443768 TGTATGTTGTAGAGGGAATGGGG - Intronic
1129037885 15:72661941-72661963 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1129212004 15:74075286-74075308 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1129398399 15:75265799-75265821 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1129402007 15:75290074-75290096 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1129729130 15:77919607-77919629 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1129839375 15:78734342-78734364 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1130144519 15:81263746-81263768 CTTTGGGTTCAGAGGGAATGAGG - Intronic
1130259724 15:82345692-82345714 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1130268995 15:82433744-82433766 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1130281509 15:82523317-82523339 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1130472882 15:84239500-84239522 GCTTTGAGGCAGAGGGAAAGAGG + Intronic
1130480373 15:84354071-84354093 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1130484591 15:84391629-84391651 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1130491396 15:84434058-84434080 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1130503012 15:84513098-84513120 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1130992955 15:88887396-88887418 GTGTTGGAGCAGAGGGGATGTGG - Intronic
1131860777 15:96651127-96651149 GTTTTGGTGCAGAAGAAAGGAGG + Intergenic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136137190 16:28263629-28263651 ATTTTGTTCCAGAAGGAATTGGG + Intergenic
1138779471 16:59765425-59765447 GTTTTCTGGGAAAGGGAATGAGG + Intergenic
1139464738 16:67148462-67148484 GCTTTATTGGAGAGGGGATGTGG - Exonic
1143379031 17:6484287-6484309 GTTCTCCTGCAGAGGGAAAGAGG + Exonic
1146457435 17:33018591-33018613 GCTTTGCTGCAGAGGCAGTGTGG + Intronic
1149195187 17:54111033-54111055 TCTTTGTTGCAGAGGAGATGTGG + Intergenic
1149537829 17:57446123-57446145 GTTAGGCTGCAGAGGGACTGGGG + Intronic
1151188586 17:72381654-72381676 GTTTTGAAGCTGGGGGAATGGGG - Intergenic
1152527619 17:80897940-80897962 GTTTTTTTGGACAGGGAATGAGG - Intronic
1154420884 18:14225201-14225223 GTTTTGTTGCAAAGAAAAGGGGG + Intergenic
1155877814 18:31108234-31108256 GGTTTGTTGTAGAGGGAGTTGGG + Intergenic
1156091719 18:33479541-33479563 TGTTTCTTCCAGAGGGAATGTGG - Intergenic
1158283421 18:55852348-55852370 GTTTTGTAGCTAAGGAAATGAGG + Intergenic
1158407999 18:57177643-57177665 TTTTTATAGGAGAGGGAATGTGG + Intergenic
1159053561 18:63443697-63443719 GTTTTATTGGAGTGGGAGTGGGG + Intergenic
1159084779 18:63776287-63776309 GTTTTGTTGGTGAAAGAATGGGG - Intronic
1161462982 19:4409841-4409863 GTTTTGTGGCAGAGTGAGCGGGG + Intronic
1163808344 19:19414361-19414383 GTTGACTTGCAGAAGGAATGAGG + Intronic
1166574045 19:43820254-43820276 GTCTTGTGACACAGGGAATGGGG - Intronic
1168082078 19:54017493-54017515 GTTTCCTAGCAGAAGGAATGTGG + Intergenic
1168360141 19:55732619-55732641 CTTTGGCTGCAGAGGGAATTTGG - Exonic
925681951 2:6431743-6431765 GGTTTAGTGCAGAAGGAATGGGG + Intergenic
926332816 2:11838928-11838950 GTATTTTTCCAGAGTGAATGGGG + Intergenic
926741115 2:16111632-16111654 GCTTTGTTTCAGAGGCAATGTGG + Intergenic
927912698 2:26912599-26912621 GCTGTGTGGCATAGGGAATGTGG - Intronic
929627100 2:43420656-43420678 GTTTTTGAGCAGAAGGAATGAGG - Intronic
930171911 2:48260429-48260451 GTTTTATTATAAAGGGAATGAGG - Intergenic
930422368 2:51169087-51169109 TTTTTCTTGCAGGGAGAATGGGG + Intergenic
934813485 2:97304530-97304552 ATGTTCATGCAGAGGGAATGAGG + Intergenic
934824211 2:97403950-97403972 ATGTTCATGCAGAGGGAATGAGG - Intergenic
935626384 2:105175368-105175390 GTTTTGCTGAGGAGGAAATGCGG + Intergenic
937814311 2:126234201-126234223 GTTTTTTTACAAAAGGAATGAGG - Intergenic
938930348 2:136081449-136081471 GTTTTGTTGGAGAGAGAGAGAGG - Intergenic
939339434 2:140874982-140875004 CTTTTGTTGCACAGGGTATAGGG - Intronic
941221186 2:162783505-162783527 TTTCTGTAGCAGACGGAATGTGG + Intronic
941857945 2:170249372-170249394 GGTTTGGGGCAGAGGAAATGTGG - Intronic
942066449 2:172276341-172276363 GTTTTAGTGAAGATGGAATGAGG + Intergenic
946978978 2:225186012-225186034 GTTTTTTTGCAGAAGGTGTGAGG - Intergenic
947820693 2:233067205-233067227 GTTTGGGTGGAGAGGGAATAGGG - Intronic
1169309078 20:4519804-4519826 GTTTTGTTTCACAGAAAATGGGG + Intergenic
1170255343 20:14336745-14336767 GTTCTATTGAAGAGGGAATATGG + Intronic
1170736679 20:19018961-19018983 GAAGTGTTGCAGAGGGAATTTGG + Intergenic
1171342831 20:24444123-24444145 GTTTTGCTGCACAGGGCAAGAGG - Intergenic
1174200360 20:48802820-48802842 CCCTTGTTGCAAAGGGAATGGGG - Intronic
1174628323 20:51934559-51934581 ATTATGTTGCAAAGTGAATGAGG - Intergenic
1175134629 20:56813809-56813831 GGCTTGTTGCAGGGGGAATGAGG - Intergenic
1175878678 20:62243864-62243886 TTTTTTTTGCAGAGGGTAGGGGG + Intronic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1179034584 21:37748525-37748547 GTTTTGTGGTAGTGGGAATGTGG + Intronic
1179122479 21:38560579-38560601 GTTTTATTGGAGGGGGAAGGGGG - Intronic
1180468957 22:15639061-15639083 GGTTTGTTGCAGAGTGAGTTTGG - Intergenic
1180590549 22:16933655-16933677 GTTTTGTTGCAGCATGAATTAGG + Intergenic
1184044695 22:41965603-41965625 GTCATGTGGCAGAGGGAAGGAGG - Intergenic
1184382503 22:44154312-44154334 GTTTTGTTGCAAAGGAATTTGGG + Intronic
1184516776 22:44967014-44967036 GTTTTCTTGCAGAGGCATTGAGG - Intronic
950365138 3:12477790-12477812 GCTTTGTTGCTGTGGCAATGTGG - Intergenic
950549745 3:13659015-13659037 GATGTTTTTCAGAGGGAATGAGG + Intergenic
951443296 3:22747547-22747569 GTTTTGTTGCAGAAGAACTACGG - Intergenic
952266553 3:31792519-31792541 GTTTTGTTGCAGCGGGGCGGAGG + Intronic
952338830 3:32428237-32428259 GGTTTGTTGCAAAGGGCCTGGGG - Intronic
952563832 3:34631257-34631279 GTTTTGGGGCAGTGGGTATGTGG - Intergenic
954304117 3:49716594-49716616 GTTTTGAGGCAGAGGGAAGGTGG + Intronic
954948042 3:54443892-54443914 GTTTTGTTGGGAAGGGCATGGGG + Intronic
956213916 3:66828522-66828544 GCTTTCTGGCAGTGGGAATGTGG + Intergenic
959429405 3:106234515-106234537 GATGGGTTTCAGAGGGAATGTGG - Intergenic
959588238 3:108046645-108046667 TGTTTGTTGAAGGGGGAATGTGG + Intronic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
961869646 3:129978034-129978056 GCTCTGCTGCAGAGGGAATCAGG + Intergenic
961894503 3:130156140-130156162 GTTTTATTGCAAAGTGATTGAGG - Intergenic
962191842 3:133319111-133319133 GTTATGTTCCAGAGGGGATTAGG - Intronic
963859032 3:150287732-150287754 GTTTTGTTGGGGATGGAATCTGG + Intergenic
964271446 3:154960570-154960592 GTTTTATTGCATAGAGAAGGAGG + Intergenic
965331390 3:167379134-167379156 GTTTAGTTGAAGTGGGAAAGAGG - Intronic
965732913 3:171791780-171791802 GTTTTGTTTTAGAGGGAGGGAGG + Intronic
966424668 3:179768232-179768254 GTTTGGCTGCAGAGGGAAGGCGG + Intronic
966776317 3:183545683-183545705 GTTTTTTTGCACTGGGAGTGGGG - Intronic
967187394 3:186956495-186956517 GTTCTATACCAGAGGGAATGAGG + Intronic
968437174 4:599751-599773 GTTTTGTTGCGGGGGGGAGGGGG + Intergenic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969132107 4:4998273-4998295 GTTTTGGGGCAGAGACAATGGGG + Intergenic
969748269 4:9090929-9090951 GTTTTATTGCAAAGTGATTGAGG + Intergenic
971022674 4:22553443-22553465 GTTTTCTTGCAAAGGTACTGTGG - Intergenic
972156317 4:36167591-36167613 CTTTTGTTGGAGAGTAAATGAGG - Intronic
972502344 4:39690434-39690456 TTTTTGGTGGAGGGGGAATGGGG + Intergenic
972622040 4:40756675-40756697 GTTTTATTTCATAGGAAATGGGG - Intronic
972653913 4:41047996-41048018 GTTTTTGTGCAGAAGGATTGAGG - Intronic
972798413 4:42446341-42446363 GTTAAGTAGCAGAAGGAATGAGG - Intronic
973758630 4:54098222-54098244 GTATAGTTGCAAAGTGAATGGGG + Intronic
975031389 4:69622110-69622132 GGTTTGTTACACAGGTAATGTGG - Intronic
975103277 4:70539038-70539060 GTTTGGTAGCAGAAGTAATGTGG - Intergenic
975725830 4:77290914-77290936 ACTTTTTTGCAGAGGGGATGGGG + Intronic
978073054 4:104494718-104494740 TTCTTGTTGCAGAGAGAAGGAGG + Exonic
978453174 4:108859349-108859371 CCTTCCTTGCAGAGGGAATGTGG - Intronic
979247932 4:118530747-118530769 CTTTTGTTGCATAAAGAATGGGG + Intergenic
979602954 4:122606401-122606423 GTTTTGTTGCAGATAGATTTTGG + Intergenic
982207624 4:153008798-153008820 CTTGAGTTGCAGAGGAAATGGGG + Intergenic
982243337 4:153322779-153322801 GTTTGGTAGCCGAGGAAATGGGG + Exonic
982338437 4:154267537-154267559 TTTTTGTTTCAGAGAGCATGTGG + Intronic
983215845 4:165001927-165001949 GTTTTGTTGAAAAGAGAAGGGGG + Intergenic
985521189 5:374541-374563 GCTTTGTGGCAGAAGAAATGGGG + Intronic
986948553 5:13053328-13053350 ATTTTGTTCCAGAGGGAGGGGGG - Intergenic
988701145 5:33676018-33676040 TTTTGTTTGCAGAGGAAATGAGG - Intronic
989330731 5:40254905-40254927 GTTTTGTTTTGGAGGGGATGAGG + Intergenic
991499284 5:67260009-67260031 GTTTTGTTGCACAGGAAATGGGG + Intergenic
991910321 5:71553254-71553276 GTTTTTTGGCAGGAGGAATGTGG - Exonic
992189545 5:74277539-74277561 CTTTTGATGCATAGGGAAAGGGG + Intergenic
992437201 5:76766201-76766223 GTGGTGTTGCAGAGGGAATGGGG + Intergenic
994397476 5:99237389-99237411 GTTTTGCATCAGAGGTAATGAGG + Intergenic
994893075 5:105664220-105664242 GTTTTGTTTGAGATGGAGTGTGG - Intergenic
995118060 5:108504253-108504275 GTATTGTTGGACAGGGAATGTGG + Intergenic
999497658 5:152115873-152115895 GTTTTATTGATGAGGAAATGTGG - Intergenic
1001946778 5:175785678-175785700 GTGTGGGTGCAGAGGGTATGTGG - Intergenic
1002864023 6:1105418-1105440 GCTTTGATGCAGTGTGAATGAGG - Intergenic
1003539346 6:7004589-7004611 GTTTCTTTCCAGAGGCAATGTGG - Intergenic
1005945922 6:30595830-30595852 GTTTTTTTGCAGGGGGAGAGAGG - Intronic
1007605841 6:43117417-43117439 GATTGGTTGTGGAGGGAATGTGG + Intronic
1011908574 6:92405724-92405746 GTTTGGTTGGAGAGTGAATCAGG - Intergenic
1012111268 6:95237899-95237921 AATTGGTTGCAGAGGTAATGTGG - Intergenic
1012931197 6:105318756-105318778 GTTTTAGTGAAGAGTGAATGGGG - Intronic
1013350427 6:109300929-109300951 GTTTTGTATGAGAGGGAAGGAGG + Intergenic
1013592272 6:111629247-111629269 GTTTTGTTGCAGAATGCATCTGG - Intergenic
1013633647 6:112008726-112008748 GTAATGATGCAGAAGGAATGTGG - Intergenic
1013669237 6:112380921-112380943 ATGTTGTTGTAGGGGGAATGTGG - Intergenic
1013703042 6:112796854-112796876 GTATGATTGCAGAGGGAAGGAGG - Intergenic
1013959285 6:115879707-115879729 CTTTTCTTCTAGAGGGAATGAGG - Intergenic
1014748751 6:125231275-125231297 GTTTTGTTGCTGAAGGAGAGAGG + Intronic
1016288067 6:142495725-142495747 ATTTTCTTCCAGTGGGAATGGGG - Intergenic
1016688642 6:146910339-146910361 ATTTTGTTGCAAGGGAAATGAGG - Intergenic
1018058102 6:160069651-160069673 GTTTTGTCACAGATGGACTGGGG - Intronic
1018439141 6:163793052-163793074 GTTTTGTTCTACAGGGAAGGAGG - Intergenic
1018998808 6:168729953-168729975 GTTTGGATGCAGAGGGGAAGGGG - Intergenic
1019082685 6:169445929-169445951 GCTCTGTTGCAGAGGGAGGGGGG - Intergenic
1019880736 7:3858613-3858635 GTTGTGTAGCAGGGGGAATAGGG + Intronic
1020324738 7:6965718-6965740 GTTTTATTGCAAAGTGATTGAGG - Intergenic
1023327715 7:39077958-39077980 GTTGTGTTGCAGATGGCCTGGGG + Intronic
1023643279 7:42283003-42283025 CATTTGTTGCAGAGGTGATGAGG - Intergenic
1024242787 7:47448277-47448299 GTTTTGTTGCAGAGGGAATGGGG - Intronic
1027190163 7:75991940-75991962 GCTTTGTAGCATGGGGAATGAGG - Intronic
1028432684 7:90765656-90765678 TTTGTGTTGAAGAGAGAATGGGG + Intronic
1029061211 7:97799756-97799778 GATTTGTTGAAGACTGAATGAGG + Intergenic
1029406352 7:100376193-100376215 GTTTTGGAGCAGATGGAAAGTGG + Intronic
1029481522 7:100816272-100816294 ATTTTGTTGGATGGGGAATGGGG + Intronic
1029953197 7:104608729-104608751 GTTTTTTTGAAGTGAGAATGAGG + Intronic
1030037784 7:105422651-105422673 ATGTTGTTGAAGAGGGAAAGAGG - Intergenic
1031099569 7:117462734-117462756 GTTTTGTGGCTGAGACAATGGGG - Intergenic
1031565014 7:123285287-123285309 GTTTTCATGGAGAAGGAATGGGG + Intergenic
1031931463 7:127690235-127690257 GATTTGTCACAGAGGTAATGAGG - Intronic
1032531701 7:132626202-132626224 AGTTTGTGGCAGTGGGAATGTGG - Intronic
1033108162 7:138549673-138549695 GTTTTGCTGCAAAAGAAATGGGG + Intronic
1036371330 8:8165223-8165245 GTTTTATTGCAAAGTGATTGAGG + Intergenic
1036555477 8:9855907-9855929 GTTTTGGTTCAGAGGGCATGTGG - Intergenic
1036879573 8:12500421-12500443 GTTTTATTGCAAAGTGATTGAGG - Intergenic
1037226092 8:16592021-16592043 TTTTTCATGCAGAAGGAATGTGG + Intergenic
1037511553 8:19588194-19588216 TTTTTTTTGCTGAGGGGATGGGG - Intronic
1039098737 8:33916515-33916537 GTTTGCATTCAGAGGGAATGAGG - Intergenic
1039269210 8:35862495-35862517 ATTTTTTAGCTGAGGGAATGGGG - Intergenic
1040398707 8:47024803-47024825 GTTTTGTTGCCTATGTAATGAGG - Intergenic
1041666122 8:60446725-60446747 ATTTGGTGGCAGAGGGAGTGGGG - Intergenic
1041702628 8:60808205-60808227 CTTTTGTTGCAGAAGGAATCTGG + Exonic
1043162667 8:76865166-76865188 GTTTTACCGCAGAGGGAATCTGG + Exonic
1044145719 8:88711287-88711309 GGAGTGTTGCAAAGGGAATGTGG - Intergenic
1045031442 8:98140210-98140232 GTTGTGTTGGGGAGGGAAGGGGG + Intronic
1045913996 8:107444492-107444514 GTTTTGTTTCACTGAGAATGAGG - Intronic
1046903382 8:119545977-119545999 GTTTTTTTGCAGAGGAGAGGTGG - Intergenic
1047127377 8:121977215-121977237 GTTTTGATGAAGAGGGAAATGGG + Intergenic
1047562073 8:125997758-125997780 GTTTTGTTGCAGCCAGAAGGTGG + Intergenic
1047833523 8:128662096-128662118 GAATTGTTGCAGATGGAAAGGGG + Intergenic
1048862279 8:138732465-138732487 GTTTTATGGCAGCTGGAATGAGG - Intronic
1048896378 8:138996201-138996223 ACTTTGTTGCACAGGGAATGGGG - Intergenic
1049755892 8:144311162-144311184 GGTCTGTTGCAGTGAGAATGAGG + Exonic
1050179895 9:2910229-2910251 GTTTTCTCCCAGAGAGAATGTGG + Intergenic
1050247007 9:3701104-3701126 GTTTTGCTGCACAGGGAGAGGGG + Intergenic
1050276658 9:4008008-4008030 GCTTAGGTGCAGAGGGAGTGTGG - Intronic
1051949514 9:22614437-22614459 GTTTTTTTGCATTGGAAATGAGG + Intergenic
1052384976 9:27811876-27811898 GTTTTGGGGCTGAGGCAATGGGG - Intergenic
1055369330 9:75580409-75580431 GTTATGGAGCAGAGGTAATGAGG - Intergenic
1059146713 9:111906315-111906337 GTATTGCTGGAGGGGGAATGAGG - Intronic
1059468945 9:114488941-114488963 GTTTTATAGCAGAAGCAATGGGG - Intronic
1059723862 9:116987024-116987046 GTATTTTTGCAGAGGGGTTGTGG - Intronic
1060798967 9:126531842-126531864 GTTTGGGTGCAGCGGGAATGGGG - Intergenic
1061063183 9:128261055-128261077 GCTTTGAGGCAGAGGGAAAGAGG - Intronic
1186936231 X:14452603-14452625 ATTTTGTTCCAGCTGGAATGGGG + Intergenic
1187199999 X:17125717-17125739 GTTATGTTGCAGAGGTAAATTGG + Intronic
1187257682 X:17656786-17656808 GGTTTCCTGCAGGGGGAATGAGG + Intronic
1189838831 X:45049485-45049507 GTTTTGTTGTATATGGTATGAGG + Intronic
1191624514 X:63255948-63255970 GTTTTGTGGCTGAGACAATGGGG - Intergenic
1191980069 X:66915927-66915949 ATTTTGTTGTAGAGGAAAGGTGG + Intergenic
1192716809 X:73651478-73651500 GTTTTGTGGCTGAGACAATGGGG - Intronic
1192994351 X:76496871-76496893 GTTTTGGGGCAGAGACAATGGGG - Intergenic
1194035878 X:88871320-88871342 GTTTTGTTTTACAGGGATTGTGG + Intergenic
1194752752 X:97702983-97703005 ATTTTGTTTCAGAGAGAATTGGG + Intergenic
1198088969 X:133308755-133308777 GCTTTGTTGCTGGGGGTATGGGG - Intronic
1198126846 X:133653317-133653339 ATTGTGTTCCATAGGGAATGTGG - Intronic
1201529870 Y:14979873-14979895 GTTTTGTAGCTGAGTGACTGTGG + Intergenic
1202366905 Y:24171807-24171829 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1202373504 Y:24213675-24213697 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic
1202497277 Y:25456445-25456467 GCTTTGAGGCAGAGGGAAAGAGG + Intergenic
1202503877 Y:25498316-25498338 GCTTTGAGGCAGAGGGAAAGAGG - Intergenic