ID: 1024242788

View in Genome Browser
Species Human (GRCh38)
Location 7:47448278-47448300
Sequence AGTTTTGTTGCAGAGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242788_1024242793 2 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242788_1024242796 11 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242796 7:47448312-47448334 CACGACGTCCCAGGGAGACATGG No data
1024242788_1024242801 27 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242801 7:47448328-47448350 GACATGGGATCCTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 129
1024242788_1024242800 24 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242800 7:47448325-47448347 GGAGACATGGGATCCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 145
1024242788_1024242794 3 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242794 7:47448304-47448326 TTGAAGTCCACGACGTCCCAGGG No data
1024242788_1024242802 28 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242802 7:47448329-47448351 ACATGGGATCCTCCCCAGGTGGG 0: 1
1: 0
2: 6
3: 12
4: 129
1024242788_1024242797 12 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242797 7:47448313-47448335 ACGACGTCCCAGGGAGACATGGG No data
1024242788_1024242803 29 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242803 7:47448330-47448352 CATGGGATCCTCCCCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242788 Original CRISPR AGTTTTGTTGCAGAGGGAAT GGG (reversed) Intronic
900266408 1:1759495-1759517 TGTTTTGTTGTCCAGGGAATTGG - Intronic
902101867 1:13996877-13996899 AGTTGGGTGGCAGAGGGAACAGG - Intergenic
904058596 1:27688484-27688506 AGCTTTATTTCAGAGGGGATGGG + Intergenic
904165126 1:28549489-28549511 AGTCTTGTTGGAGCCGGAATGGG - Intergenic
904688927 1:32279480-32279502 GGTTTTTTTGCAGAGGGGCTAGG - Intronic
905599591 1:39238273-39238295 AGGTCTCTTGGAGAGGGAATGGG + Intronic
910171498 1:84382547-84382569 AGTTTAGTTATAGAGTGAATTGG - Intronic
910938051 1:92503123-92503145 AGTGTTGTGGCAGAGGGCAAAGG - Intergenic
913209742 1:116572264-116572286 AGGTTTGTGGTAGAGGGCATTGG - Intergenic
913424999 1:118718688-118718710 AGTTTTTTTGCAGAGGGTAGGGG - Intergenic
914487356 1:148122413-148122435 AGCTCTGTTGCAGAGAGAAGAGG - Intronic
917344232 1:174012435-174012457 AGTTATTTTGAAGAGGGTATTGG - Intronic
918052641 1:180987899-180987921 ATTTTTGTTCCAGAGAGGATAGG - Intronic
918877231 1:190063615-190063637 ATTTTTGATGCTGAGGAAATAGG - Intergenic
918881871 1:190134673-190134695 AGTTTTATTCCAGAGCAAATGGG + Intronic
919789214 1:201279524-201279546 AGTTCAGTTGCAGACGGACTGGG + Intergenic
920068327 1:203284880-203284902 AGTGTTTTTGAAGAGGGAAGAGG + Intergenic
920313283 1:205061008-205061030 AGGGTTGTTGCAGGGGGGATGGG + Intronic
924019139 1:239762107-239762129 AGTTTTGTAGTTGAGGCAATAGG + Intronic
924353874 1:243148882-243148904 ACTTTTGTTGCATAAAGAATGGG - Intronic
1063255368 10:4321404-4321426 AGTTTTATGGTAGAGAGAATTGG + Intergenic
1064973295 10:21088161-21088183 AGTCTTCTGGCAGAGGGAAAGGG + Intronic
1065128418 10:22596569-22596591 TGTTTTGTTGCAAAGGAAAAAGG + Intronic
1065266981 10:23986695-23986717 AATTTTGTTGCAGAAAGAAAGGG - Intronic
1065701511 10:28430327-28430349 AGTTTTGAGGCAGGGAGAATAGG - Intergenic
1066006066 10:31147158-31147180 AGTTTTGTTGCAGGGGACTTGGG + Intergenic
1066438169 10:35413185-35413207 AGATGAGTTGCAGAGGGAAGTGG + Intronic
1069798595 10:71068790-71068812 AGTTGTGTTGCATAGGGAAGAGG + Intergenic
1070994568 10:80764879-80764901 TCTTGTGTTGCAGAGGGAGTTGG + Intergenic
1072333477 10:94376047-94376069 AGTGGTGTTGCACAGAGAATGGG - Intergenic
1072542176 10:96406600-96406622 AGATTTGGTGGGGAGGGAATGGG - Intronic
1073713138 10:106068856-106068878 AGGTTTGTTACATAGGTAATTGG + Intergenic
1074475263 10:113767974-113767996 AGGGTTGTTGCAGATGTAATTGG - Intronic
1074942451 10:118248522-118248544 AGGGTTATTGCAGAGGCAATTGG - Intergenic
1076269913 10:129143160-129143182 AGTTTTTCCCCAGAGGGAATTGG + Intergenic
1076741463 10:132487891-132487913 TGGTTTATAGCAGAGGGAATTGG + Intergenic
1077404335 11:2376395-2376417 AGTTTTCTTGGAGAGGGCATGGG + Intronic
1078331635 11:10427012-10427034 CGTGGTGTTTCAGAGGGAATCGG - Intronic
1078963650 11:16310608-16310630 ACTTTTGGTGCAGAAGCAATTGG - Intronic
1080469726 11:32533259-32533281 AGTTATGTGGAAGTGGGAATGGG + Intergenic
1080774250 11:35371037-35371059 TGTTTTCTTGCAGAGACAATGGG + Intronic
1081446886 11:43139333-43139355 AGGGTTGTTGCAGATGTAATTGG + Intergenic
1082773096 11:57223979-57224001 ATTTTTGATGCAGAATGAATAGG - Intergenic
1084648437 11:70474179-70474201 AGTTTTGTTGCAGAAGGAGCTGG + Intronic
1085954630 11:81376960-81376982 AGATTAGTTACAGAGGGAAAAGG - Intergenic
1086162541 11:83738538-83738560 TGTTTTGAGGCAGAGGAAATTGG - Intronic
1087412648 11:97811148-97811170 AGATTTTTTGAAGATGGAATAGG + Intergenic
1087788963 11:102387021-102387043 AGTTTTGTTCCATAGTGAGTAGG + Intergenic
1093294420 12:17370401-17370423 AGTTTTGTTTTAAAGGTAATAGG + Intergenic
1093715366 12:22375993-22376015 AGTTTTGATGCAGGGGGAGAAGG - Intronic
1094060677 12:26312213-26312235 AGTTTTGGGGCTGAGGCAATGGG + Intergenic
1094275390 12:28669087-28669109 AGTTTGGTGGCAGGGGGAACAGG - Intergenic
1095653338 12:44639917-44639939 AGGTTTGATGCATAGTGAATTGG - Intronic
1097896762 12:64832201-64832223 AGTTTTGTTCCATCGGGCATAGG - Exonic
1098041974 12:66361800-66361822 CAATCTGTTGCAGAGGGAATTGG - Intronic
1102743359 12:115227636-115227658 AGGTGTGTTGCAGAGTTAATAGG - Intergenic
1104372029 12:128231918-128231940 AGATTGGTAGCAGGGGGAATGGG - Intergenic
1104490269 12:129188074-129188096 AGTTCTGTTGCAAAGAGGATGGG - Intronic
1106285006 13:28310667-28310689 CGTATTACTGCAGAGGGAATTGG - Intronic
1108227642 13:48305120-48305142 AAGTTCATTGCAGAGGGAATGGG + Intronic
1109573708 13:64226026-64226048 AGATTTGTTGCAGAGGCACAGGG - Intergenic
1111675305 13:91379725-91379747 AGTTTTGTACTAGAGGGGATAGG - Intergenic
1112507638 13:99984796-99984818 AGTTCTGCCGCAGAGGGGATCGG + Intronic
1112791936 13:103012679-103012701 AGTTTTACAGCACAGGGAATTGG + Intergenic
1115543705 14:34446160-34446182 AGTTTTGTTGTAGTGTGGATGGG - Intronic
1115957628 14:38798865-38798887 AGTTTTGTTGGAGAGGGACTGGG + Intergenic
1116685328 14:48032020-48032042 AGTTTTGGGGCTGAGGCAATAGG + Intergenic
1119192489 14:72692614-72692636 GGTTTTGTTGTAGAGGGGAGGGG - Intronic
1120151893 14:81045436-81045458 AGGTTTGTTGCATAGGTAAATGG + Intronic
1120601179 14:86511854-86511876 AGAGTTTTTGTAGAGGGAATAGG - Intergenic
1122468157 14:101948382-101948404 GGTTTTGCTGCGGAGGGAAACGG + Intergenic
1122654139 14:103245934-103245956 AGTTTAGCTGCACAAGGAATTGG + Intergenic
1125572492 15:40731577-40731599 AGCTATGTAGCAAAGGGAATGGG + Exonic
1127358791 15:58226791-58226813 AGTGTTGTCACAGAGGGAACCGG - Intronic
1127516120 15:59694924-59694946 ATCTTTCTGGCAGAGGGAATTGG + Intergenic
1128903168 15:71443747-71443769 ATGTATGTTGTAGAGGGAATGGG - Intronic
1129046584 15:72739996-72740018 AGCTTTGATGTAGAGGGAAGAGG + Intergenic
1134508264 16:14824978-14825000 ATTCTTGTTGCAGGGGGAAGAGG - Intronic
1134695963 16:16223743-16223765 ATTCTTGTTGCAGGGGGAAGAGG - Intergenic
1134975863 16:18570945-18570967 ATTCTTGTTGCAGGGGGAAGAGG + Intergenic
1136137189 16:28263628-28263650 GATTTTGTTCCAGAAGGAATTGG + Intergenic
1136662660 16:31778061-31778083 AGGTTTGTTGCACAGGTAAATGG - Intronic
1139128510 16:64111766-64111788 AACTTAGTTGCAGAGGAAATAGG - Intergenic
1140030580 16:71335038-71335060 ACCTTTGGTGCAGAGGGAAGTGG + Intergenic
1140737727 16:77913104-77913126 TGTTTTGTAGCAAAGGGGATCGG - Intronic
1141734203 16:85841278-85841300 AGCTTTGCTGCAGCGAGAATCGG + Intergenic
1143957612 17:10685158-10685180 AGTTGAGATGCAGAGGGGATGGG - Intronic
1148004258 17:44412847-44412869 TGTTTTGTTGTAGAGGGAGGGGG - Intronic
1149874765 17:60221034-60221056 AGTTCTGTTGCAGAAGATATTGG - Intronic
1150088552 17:62298274-62298296 AGTTCTGTTGCAGAAGATATTGG - Intergenic
1150601409 17:66654088-66654110 AGTGTTCTTGCAGAGAGGATTGG + Intronic
1151021796 17:70625297-70625319 ACTTTTGTTGCAGAGTGAACTGG - Intergenic
1151167436 17:72217490-72217512 AGTTCTTTTTCAGAGGGTATTGG + Intergenic
1151188587 17:72381655-72381677 AGTTTTGAAGCTGGGGGAATGGG - Intergenic
1153032855 18:731340-731362 AGTTTTGTTGGAGAGGACAATGG + Intronic
1154024070 18:10690320-10690342 AGTTGTGTTTCAGAAGGGATTGG + Intronic
1155559327 18:27058807-27058829 AGTTTTGTGGCTTAGGGATTTGG - Intronic
1155853087 18:30796826-30796848 AGGTTTGTTGCAAATGTAATTGG + Intergenic
1155877813 18:31108233-31108255 TGGTTTGTTGTAGAGGGAGTTGG + Intergenic
1155903323 18:31418537-31418559 AATTTTGTTGAATAGAGAATTGG - Intergenic
1156839321 18:41592599-41592621 AGCTTTGTTGCAGATGCTATAGG - Intergenic
1157750292 18:50172463-50172485 AGTTTTGTTATACATGGAATTGG + Intronic
1158643365 18:59221197-59221219 GGACCTGTTGCAGAGGGAATGGG - Intronic
1159051989 18:63428919-63428941 AGTTTTGTTGGAGTAAGAATAGG - Intergenic
1159597579 18:70397345-70397367 GATTTTATTGCAAAGGGAATTGG + Intergenic
1161732705 19:5971513-5971535 AGTTTTTTTCCAGAGGTTATTGG - Intronic
1163792534 19:19316161-19316183 AGCTGTGGTGCAGAGGGAAGGGG - Intronic
1164614425 19:29658042-29658064 AGTTCTCTTCCACAGGGAATAGG - Intergenic
1165072127 19:33261619-33261641 AGTTTAGTGGAAGAGGAAATGGG - Intergenic
1202677978 1_KI270711v1_random:24851-24873 TGTTCTGTTGCAGAGAGAAGAGG - Intergenic
925156646 2:1653307-1653329 TCATTTGTTGCAGAGGGACTGGG + Intronic
928700241 2:33891637-33891659 ACTTTTGTGGCAGAAGTAATGGG - Intergenic
929903281 2:46024314-46024336 TTTTTTTTTGCAGAGGCAATAGG + Intronic
930741735 2:54838597-54838619 AGGACTGTAGCAGAGGGAATTGG + Intronic
931766584 2:65462210-65462232 TGTTTTGTTTCAGAGGGAAGAGG - Intergenic
931792412 2:65676382-65676404 GGTTTTGTTTCAGAGGAAACTGG + Intergenic
932543514 2:72682476-72682498 AGTTTTCTTACAGAAGGGATGGG - Intronic
933548655 2:83745738-83745760 AGGTTTGTTGCAGATGGAAAAGG - Intergenic
935463586 2:103368294-103368316 AATTTAGTTTCAGAGGGAAAAGG - Intergenic
935658393 2:105444135-105444157 AGTTCTGGGGCAGAGAGAATAGG + Intergenic
938739609 2:134218775-134218797 AGTCTTATTGCAAGGGGAATGGG + Intronic
939339435 2:140874983-140875005 GCTTTTGTTGCACAGGGTATAGG - Intronic
941638140 2:167958482-167958504 AGTTTTCTTGCAGTGGGTAGGGG - Intronic
942310378 2:174650964-174650986 ACTTTTGATTCACAGGGAATTGG + Intronic
942912366 2:181260317-181260339 CGTTTAGTGGCAGAGGGACTTGG - Intergenic
944887001 2:204073059-204073081 AGTTTTGTGGCAGAGTCATTGGG + Intergenic
945826896 2:214731798-214731820 AGTTTAATAGCAGAGGGTATCGG + Intronic
947031820 2:225805024-225805046 AGTGTTGTTATAAAGGGAATTGG + Intergenic
947244192 2:228028955-228028977 ACTTTTGTTGGGTAGGGAATGGG + Intronic
947820694 2:233067206-233067228 GGTTTGGGTGGAGAGGGAATAGG - Intronic
1170080706 20:12471348-12471370 AGATTTTATGCTGAGGGAATAGG - Intergenic
1170160058 20:13301696-13301718 ATTTTTTTTGCAAAGAGAATTGG + Intergenic
1170199404 20:13726332-13726354 AGCATTGTCGGAGAGGGAATTGG - Intronic
1170373034 20:15670126-15670148 TGTTTTCTTGCAGAGAAAATGGG + Intronic
1173769303 20:45644515-45644537 ATTTTTTTTGTAGAGGGCATGGG + Intergenic
1174516263 20:51094793-51094815 AGTTTTGTGGAAGAGAAAATAGG + Intergenic
1175878677 20:62243863-62243885 ATTTTTTTTGCAGAGGGTAGGGG + Intronic
1178026507 21:28474485-28474507 AGTTTTAGTGCAGAGGGCACGGG - Intergenic
1182205378 22:28618978-28619000 ATTTCTGTTGCAGAGGGAAAAGG - Intronic
1182313088 22:29423242-29423264 AGTTATGGTGCAGAGGGAGGAGG + Intergenic
1183694658 22:39414921-39414943 GTTTTTGTTGCAGAAGGAATAGG + Intronic
1183781343 22:40000954-40000976 AGCTTTGTTTCAGAGGCACTGGG + Intronic
1184382502 22:44154311-44154333 TGTTTTGTTGCAAAGGAATTTGG + Intronic
949419781 3:3853499-3853521 AGTTTTTGTGCAGAGGGGAGAGG + Intronic
952634082 3:35505786-35505808 AGTTGGGTGGCACAGGGAATAGG - Intergenic
955238639 3:57161533-57161555 TGTTTTCTTGCAGGGGGAGTAGG + Intronic
956359060 3:68427441-68427463 AGTGTTGTTGCAGAAGGACAGGG - Intronic
956865366 3:73363839-73363861 AGTGTTGTTGCAGAGTAGATGGG - Intergenic
957111986 3:75973746-75973768 AGCTAAGTAGCAGAGGGAATGGG + Intronic
957179732 3:76861061-76861083 ACTGATGTTGCAGAGGGAAGAGG - Intronic
958059947 3:88466956-88466978 GGTTTTCTTTCATAGGGAATGGG - Intergenic
959310585 3:104730561-104730583 AATATTGTTGCACTGGGAATTGG + Intergenic
959320848 3:104873320-104873342 ATTTCTGTTGCACAGGGAGTTGG + Intergenic
959720566 3:109482635-109482657 AGTTTTGTAGCAGGAGGATTTGG - Intergenic
960136013 3:114106083-114106105 AGTTTTATTGTAGAAGGCATTGG + Intergenic
960383937 3:116996804-116996826 ACTTTTGTTGGAGAGAGAAATGG + Intronic
960745733 3:120886377-120886399 GGTTTTGTTGTAAAGGGAAATGG - Intergenic
961267237 3:125653473-125653495 AGTTTTGATTCAGTGGGCATAGG + Intergenic
962853504 3:139325132-139325154 AGTTGGGTTGGAGAGGGAATGGG + Intronic
963381262 3:144533426-144533448 AGTTCTTTTGCAGAGGGGTTGGG - Intergenic
964598854 3:158472479-158472501 TGTTTTGTTGAAGATGCAATAGG - Intronic
965560688 3:170059726-170059748 AGGTTTGTTACACAGGGAAACGG + Intronic
966214320 3:177486381-177486403 ATTTTTGTGTCTGAGGGAATAGG + Intergenic
966441158 3:179945891-179945913 TGTGTGGTTGCAGAGGGAAATGG + Intronic
966794463 3:183699972-183699994 AGTTTTGGGGCAGATGGAAATGG - Intronic
970096399 4:12467712-12467734 AGTGTTGTTTCATTGGGAATGGG - Intergenic
971613063 4:28751085-28751107 AGGTTTTTCTCAGAGGGAATGGG + Intergenic
971934758 4:33133491-33133513 AGTGAAGATGCAGAGGGAATGGG + Intergenic
972334118 4:38091533-38091555 ATTTTTGTTGAAGAGGAAAAAGG + Intronic
972532087 4:39970626-39970648 AGTTTAGTGGCAGAGGGCAGGGG - Intronic
973663008 4:53127238-53127260 AGTTTGGTTGAAGAAGGAATTGG - Intronic
974094535 4:57348838-57348860 AGTTTTGGGGCAGAGGCTATTGG + Intergenic
974181157 4:58386361-58386383 AGTTTGGTGGCACAGGGAACAGG + Intergenic
974671733 4:65038869-65038891 AATTTAGTTGCAGAGGGAAAAGG - Intergenic
975140928 4:70917565-70917587 AGTTTTGTTGTAGTGTGGATGGG + Intronic
975269624 4:72416483-72416505 AGGTTTGTTCCAGAGGGTATGGG - Intronic
975755115 4:77564267-77564289 AGATTTGCTGCAGAGAGAGTGGG + Intronic
979247931 4:118530746-118530768 ACTTTTGTTGCATAAAGAATGGG + Intergenic
979735110 4:124073241-124073263 AGTTGGGTGGCACAGGGAATAGG - Intergenic
979846238 4:125516184-125516206 AGTGTTGTGTCACAGGGAATAGG + Intergenic
980841098 4:138262350-138262372 AGTTTTGGTGCAAAGCAAATTGG + Intergenic
982179091 4:152733390-152733412 AGTTTTGCTCTAGAAGGAATTGG + Intronic
982207623 4:153008797-153008819 ACTTGAGTTGCAGAGGAAATGGG + Intergenic
982462740 4:155691284-155691306 AACTTTGTGGCAGAGAGAATTGG + Intronic
982577168 4:157127926-157127948 AATTTTGTTACAGTGGCAATTGG + Intronic
983187206 4:164713751-164713773 AGTGCTGTTACAGAGGGAGTAGG - Intergenic
983911676 4:173246856-173246878 AGTTTTAGTGTAGAGGGAAGTGG + Intronic
983966933 4:173823928-173823950 AACTTTGATGCATAGGGAATAGG + Intergenic
984128633 4:175844346-175844368 AGTCTTGTGGCAGAAGGAATTGG - Intronic
984579679 4:181497407-181497429 ATTTTTGTTCCAGTGGTAATTGG + Intergenic
985077246 4:186227916-186227938 AGTAATGTTGGAAAGGGAATTGG - Intronic
985841599 5:2309961-2309983 TGTCTTGTTGGAGAGAGAATCGG + Intergenic
986741584 5:10710142-10710164 TGTTTTGTAGCCGAGGGAAGGGG - Intronic
986948554 5:13053329-13053351 AATTTTGTTCCAGAGGGAGGGGG - Intergenic
986988426 5:13524764-13524786 AGTTTGGTGGCCAAGGGAATGGG - Intergenic
990159282 5:52919047-52919069 AATTCTGTTGCAAAAGGAATAGG + Intronic
991188623 5:63841418-63841440 ATTTTTGTGTCATAGGGAATAGG - Intergenic
991499283 5:67260008-67260030 AGTTTTGTTGCACAGGAAATGGG + Intergenic
992136763 5:73753502-73753524 AGTTTTCTTGCTGTGGGAAGGGG + Intronic
992437200 5:76766200-76766222 AGTGGTGTTGCAGAGGGAATGGG + Intergenic
995231336 5:109767685-109767707 AGTTTTTTTGGAGACAGAATTGG + Exonic
995450358 5:112293385-112293407 AGTTTTGGTGAAGAAGGCATTGG + Intronic
995566711 5:113438455-113438477 AGTTATCTTACAGAGGCAATAGG + Intronic
995570665 5:113477654-113477676 ATTTGTGGTGCAGAGGGAAGAGG + Intronic
996893071 5:128446237-128446259 AGTTGTGTTGCATTGAGAATGGG - Intronic
998548719 5:143055250-143055272 AGATTTTTTGAAGATGGAATTGG + Intronic
1000531478 5:162426814-162426836 AGGTTTGTAGCAGAGATAATAGG - Intergenic
1003754244 6:9098702-9098724 AGTTTTGTAGAAGAGAGTATCGG - Intergenic
1004191637 6:13469109-13469131 AGTTATGTAGGAGAGGGAGTTGG + Intronic
1004252639 6:14034636-14034658 AGTTTTGTTCTAAAGGCAATGGG + Intergenic
1004470168 6:15921947-15921969 AGGGTTGTTGCAGATGTAATTGG + Intergenic
1004637460 6:17482793-17482815 AGGGTTGTTGCAGATGTAATTGG - Intronic
1007119174 6:39366192-39366214 AGTGGTGTTGCGCAGGGAATGGG - Intronic
1007468636 6:42073619-42073641 AGTGTTCTGGCAGAGGGAATGGG + Intronic
1007757527 6:44109895-44109917 AGTTATCTAGCAGAGGGAGTAGG + Intergenic
1010777328 6:79902315-79902337 AATTTTGTGGATGAGGGAATTGG - Intergenic
1011355422 6:86468459-86468481 AGTTTTGTTGCTGGGTGATTAGG - Intergenic
1012743706 6:103055110-103055132 AGTATTGTTGGAGAGGAGATTGG - Intergenic
1012948709 6:105495055-105495077 TGATTTGTTGCAGCAGGAATCGG - Intergenic
1015807639 6:137127398-137127420 AGTGTAGTTGCTGAGAGAATAGG + Intergenic
1016093640 6:140009560-140009582 AGTTTGGTAACAGTGGGAATGGG + Intergenic
1016397639 6:143642584-143642606 AGGGTTGTTGCAGATGTAATTGG + Intronic
1016921964 6:149304421-149304443 ACTTTTGTTACTGAAGGAATAGG - Intronic
1018281539 6:162191228-162191250 ATTTTTTTTGGAGATGGAATGGG + Intronic
1019082686 6:169445930-169445952 AGCTCTGTTGCAGAGGGAGGGGG - Intergenic
1019831805 7:3337776-3337798 ATTTTTGTTGCATATAGAATTGG - Intronic
1019880735 7:3858612-3858634 TGTTGTGTAGCAGGGGGAATAGG + Intronic
1020564324 7:9777030-9777052 TGTATTGTTTCACAGGGAATGGG + Intergenic
1023090537 7:36614083-36614105 AGTTTTCTGGGAGAGGGAAGAGG + Intronic
1024242788 7:47448278-47448300 AGTTTTGTTGCAGAGGGAATGGG - Intronic
1024507273 7:50172672-50172694 AGATTTGTTGTAAAGGAAATGGG - Intergenic
1028419541 7:90617299-90617321 AGTTTGGATGCAGAGAGACTAGG - Intronic
1028921123 7:96311499-96311521 AGTTTATTTGATGAGGGAATTGG - Intronic
1031099570 7:117462735-117462757 AGTTTTGTGGCTGAGACAATGGG - Intergenic
1031706890 7:124992063-124992085 AGATTTGTTACAGAGAAAATAGG + Intergenic
1032274047 7:130439348-130439370 AGTTTTTTTGCAGGGGGGAGGGG + Intronic
1033108161 7:138549672-138549694 AGTTTTGCTGCAAAAGAAATGGG + Intronic
1033652387 7:143352825-143352847 AGTTTTCTGCCAGAGGGAGTCGG - Intergenic
1035118070 7:156541658-156541680 ATTTTTGTTGAAAAGGGAAATGG + Intergenic
1035990997 8:4489974-4489996 AATTTTGTGGCAAAGGCAATTGG - Intronic
1038878644 8:31581231-31581253 AGTTTTGGTGCAGTGGCAAGTGG + Intergenic
1040886510 8:52269247-52269269 AATTTTGTTGCAGAGATAAATGG + Intronic
1043288693 8:78568851-78568873 ACTTTTGTTTCAGAGGGACCAGG + Intronic
1043289987 8:78586527-78586549 AGATTTGTGGGAGATGGAATAGG + Intronic
1043674454 8:82933617-82933639 AGTGTTGTTGCAGAGGTTAGAGG + Intergenic
1046303048 8:112323446-112323468 AGGGTTGTTGCAGACGTAATTGG + Intronic
1046767599 8:118086824-118086846 AGTTTTGTAGTAGACAGAATGGG + Intronic
1047127376 8:121977214-121977236 AGTTTTGATGAAGAGGGAAATGG + Intergenic
1047166197 8:122441097-122441119 AATTGTGTGGCATAGGGAATTGG + Intergenic
1047437958 8:124850858-124850880 ATTGTTGTTGTAGAAGGAATGGG - Intergenic
1047438093 8:124852017-124852039 AATGTTGTTGCAGAAGGAGTGGG - Intergenic
1047833522 8:128662095-128662117 AGAATTGTTGCAGATGGAAAGGG + Intergenic
1048896379 8:138996202-138996224 AACTTTGTTGCACAGGGAATGGG - Intergenic
1049894514 9:101021-101043 AGGGTTGTTGCAGATGTAATTGG + Intergenic
1052384977 9:27811877-27811899 AGTTTTGGGGCTGAGGCAATGGG - Intergenic
1052389566 9:27863255-27863277 AGTTTTTTTGCAAAGCTAATTGG - Intergenic
1053011244 9:34635032-34635054 AGCTTTGTTGCTGAGGGGGTTGG + Exonic
1053109994 9:35451413-35451435 AGGTCTGGTGCAGTGGGAATAGG + Intergenic
1053735723 9:41101011-41101033 AGGGTTGTTGCAGATGTAATTGG + Intergenic
1054692656 9:68330387-68330409 AGGGTTGTTGCAGATGTAATTGG - Intronic
1055603485 9:77944482-77944504 AGTTTGGTGGAGGAGGGAATAGG - Intronic
1056034044 9:82585002-82585024 GGTTTGGATGCAGAGAGAATGGG - Intergenic
1056052349 9:82782531-82782553 AGTCATTTTGCAGAGGAAATTGG - Intergenic
1057567751 9:96180143-96180165 AATTTTGTTGAAGAGGGAACTGG + Intergenic
1057982648 9:99676976-99676998 AGTTTTGTTGAAGAAAAAATTGG + Intergenic
1058763201 9:108156597-108156619 AGTTTCTTAGCAGAGAGAATGGG - Intergenic
1059468946 9:114488942-114488964 AGTTTTATAGCAGAAGCAATGGG - Intronic
1060798968 9:126531843-126531865 GGTTTGGGTGCAGCGGGAATGGG - Intergenic
1062188918 9:135236813-135236835 AGATTTGTTACAGTGGCAATGGG - Intergenic
1187800411 X:23056067-23056089 ATTTTTGTTTCTTAGGGAATAGG - Intergenic
1189055871 X:37698975-37698997 AGCTTTATTCCAGAGGCAATGGG + Intronic
1191624515 X:63255949-63255971 AGTTTTGTGGCTGAGACAATGGG - Intergenic
1191668755 X:63729814-63729836 AGTTTTGTTGATGTGGGAGTGGG - Intronic
1192079407 X:68032771-68032793 AGTACTGCTGCTGAGGGAATAGG - Intergenic
1192716810 X:73651479-73651501 AGTTTTGTGGCTGAGACAATGGG - Intronic
1192994352 X:76496872-76496894 AGTTTTGGGGCAGAGACAATGGG - Intergenic
1194752751 X:97702982-97703004 CATTTTGTTTCAGAGAGAATTGG + Intergenic
1195983177 X:110601420-110601442 AGTTTGGTGGCACAGGGAACAGG - Intergenic
1198158244 X:133983937-133983959 TGTTTAGTTGCAAAGGTAATTGG - Intronic
1201355522 Y:13093208-13093230 GGTTTTTTTGCAGGGGAAATGGG + Intergenic