ID: 1024242789

View in Genome Browser
Species Human (GRCh38)
Location 7:47448279-47448301
Sequence AAGTTTTGTTGCAGAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 328}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242789_1024242794 2 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242794 7:47448304-47448326 TTGAAGTCCACGACGTCCCAGGG No data
1024242789_1024242800 23 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242800 7:47448325-47448347 GGAGACATGGGATCCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 145
1024242789_1024242801 26 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242801 7:47448328-47448350 GACATGGGATCCTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 129
1024242789_1024242796 10 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242796 7:47448312-47448334 CACGACGTCCCAGGGAGACATGG No data
1024242789_1024242793 1 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242789_1024242803 28 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242803 7:47448330-47448352 CATGGGATCCTCCCCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 191
1024242789_1024242797 11 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242797 7:47448313-47448335 ACGACGTCCCAGGGAGACATGGG No data
1024242789_1024242802 27 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242802 7:47448329-47448351 ACATGGGATCCTCCCCAGGTGGG 0: 1
1: 0
2: 6
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242789 Original CRISPR AAGTTTTGTTGCAGAGGGAA TGG (reversed) Intronic
900868586 1:5286035-5286057 AAGTCTTGGTTCAGAGGAAAAGG + Intergenic
905638268 1:39570686-39570708 AAGTTTTTCTGCAAAGGGATGGG + Intronic
906204696 1:43980419-43980441 ACGTTTTGCTCCAGTGGGAAGGG + Intronic
906914484 1:49994192-49994214 AAGTAGTCTTGCAGGGGGAAGGG + Intronic
909038396 1:70621936-70621958 AAGTTTTTATGGAGAGGCAAAGG - Intergenic
909569794 1:77096324-77096346 AAGTCACGTTGCAGAGGGTATGG - Intronic
909576073 1:77177799-77177821 AAGTTTTGTTGCAGTGTGGATGG - Intronic
911828505 1:102519421-102519443 GTAGTTTGTTGCAGAGGGAAAGG - Intergenic
912800270 1:112715540-112715562 AGGTTCTGTTGCTGTGGGAAGGG + Intergenic
913425000 1:118718689-118718711 TAGTTTTTTTGCAGAGGGTAGGG - Intergenic
916035301 1:160916649-160916671 AAGTTTTGCTGCAGTGTGGATGG + Intergenic
916241082 1:162640438-162640460 AGGTTTTGTAGCAGAGGACAAGG + Intronic
916287533 1:163126795-163126817 AATTCATTTTGCAGAGGGAAAGG + Intronic
916910746 1:169343109-169343131 ATTTTTTGTTGGGGAGGGAATGG + Intronic
917147354 1:171906449-171906471 AAGTTTTGTTGCTGGGGGTCGGG - Intronic
918321152 1:183365968-183365990 CATTTTTGATGGAGAGGGAAAGG - Intronic
918518440 1:185387855-185387877 AAGTTTTGTAGCTGAGGTTAAGG + Intergenic
918776850 1:188642951-188642973 AAGTTTTAAAGCAGAGGCAAAGG - Intergenic
919789213 1:201279523-201279545 AAGTTCAGTTGCAGACGGACTGG + Intergenic
920122495 1:203669234-203669256 AGGTTTTGGTGCAGATAGAAGGG - Intronic
921836036 1:219779628-219779650 AAGTTTAGTTACACAGGGTAAGG + Intronic
922158401 1:223058814-223058836 AAGTTTTGTTGCAGTGTGAATGG + Intergenic
922759069 1:228114029-228114051 AAGTTTTGTTGCAGTGTAGAAGG + Intergenic
923113096 1:230908922-230908944 AAGGTATGTTGGAGCGGGAAGGG - Exonic
923292118 1:232556171-232556193 AAGTTTTGTAACAGACAGAAAGG - Intronic
923515584 1:234695429-234695451 AAATTATGCTGCAGAAGGAATGG - Intergenic
1063972923 10:11393959-11393981 TAGTTTTGGGGGAGAGGGAAAGG - Intergenic
1064973294 10:21088160-21088182 CAGTCTTCTGGCAGAGGGAAAGG + Intronic
1065266982 10:23986696-23986718 TAATTTTGTTGCAGAAAGAAAGG - Intronic
1065807311 10:29406119-29406141 AAGTTTTGTTGCAGTGTGAATGG + Intergenic
1067276072 10:44835227-44835249 AAGTTTTAGTGAAGATGGAAAGG - Intergenic
1068315530 10:55336727-55336749 AAGTTTGTTTGGAGAGCGAAAGG - Intronic
1070252178 10:74782574-74782596 AGGTTTTCTTGCAAAGGGAGGGG + Intergenic
1070438946 10:76423628-76423650 AAATTTTGTTATAAAGGGAATGG + Intronic
1072632931 10:97159148-97159170 AAGCTTACTTCCAGAGGGAAGGG + Intronic
1075254852 10:120917630-120917652 AGGCTTTGTGGCAAAGGGAAGGG - Intergenic
1075910718 10:126123513-126123535 AAGTTCTGGGGCAGAGAGAAGGG + Intronic
1076116330 10:127904385-127904407 AAGCTGTGTTTTAGAGGGAAGGG + Intergenic
1076630869 10:131851308-131851330 AAGATTTGTGGCAGGTGGAAAGG - Intergenic
1076654325 10:132012968-132012990 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1077404334 11:2376394-2376416 CAGTTTTCTTGGAGAGGGCATGG + Intronic
1078150140 11:8751448-8751470 AAGATTTATTGCAGGGCGAAAGG - Intronic
1078311758 11:10250783-10250805 AAGTTTTGTTGCAGTGTGAATGG - Intronic
1078474155 11:11616661-11616683 AGGGTTTGTTACAGAGGGAATGG - Intronic
1078941425 11:16010653-16010675 AACTATTGTTGCTGGGGGAAAGG + Intronic
1079486589 11:20941550-20941572 CCGTTATGTTGCAGTGGGAATGG - Intronic
1079938247 11:26644136-26644158 AAGTTTTGTTACGGTTGGAAGGG - Intronic
1080436502 11:32249806-32249828 AAGGTTTACTGCAGAGGGGAGGG - Intergenic
1080719341 11:34834090-34834112 CAGGTTTGTTACATAGGGAAAGG + Intergenic
1082859483 11:57840830-57840852 AAGTGGAGATGCAGAGGGAAAGG - Intergenic
1086098878 11:83077769-83077791 AAGTTTGGTCGGAGAGGGTAGGG - Intergenic
1086742521 11:90385133-90385155 AGGTTTTCTTGCTGAGGGTAGGG + Intergenic
1088103757 11:106183087-106183109 AAGTTTTGTTGCAGTGTGGATGG - Intergenic
1088104345 11:106189167-106189189 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1090351170 11:126109619-126109641 AAGATTTGGAGAAGAGGGAAAGG - Intergenic
1093072071 12:14716041-14716063 TAGTTTTGGGGGAGAGGGAAAGG + Intergenic
1093241298 12:16679295-16679317 CAGTTTTATTGAAGAGGGTAGGG + Intergenic
1093886498 12:24467577-24467599 AAGTTTTGTTGTGGCAGGAAAGG + Intergenic
1093989376 12:25572818-25572840 AAGTTATCTGGCAGAAGGAAGGG - Intronic
1094060676 12:26312212-26312234 AAGTTTTGGGGCTGAGGCAATGG + Intergenic
1094239639 12:28207367-28207389 AAGTTTTGTTGCAGAATGGATGG + Intronic
1094494951 12:30983290-30983312 AGCCTTGGTTGCAGAGGGAAGGG - Intronic
1095559163 12:43545120-43545142 AAGTAATGTTGCAGTGGGGAAGG - Intronic
1096878751 12:54650264-54650286 AAGCTTGGTTGCAGAAGGATTGG - Intergenic
1096943728 12:55380349-55380371 AAGTTTTTTTGCAGAAAGCAAGG + Intergenic
1097441991 12:59620346-59620368 AATTTTTTTTTCAGAGGAAAGGG - Intronic
1097604980 12:61742847-61742869 TAGTGTGGGTGCAGAGGGAAGGG - Intronic
1098294369 12:68989492-68989514 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1098469027 12:70823042-70823064 ACTTTGTGTTGCTGAGGGAAAGG - Intronic
1098502513 12:71210028-71210050 AAGTTTTGTTGCAGTGTGGATGG - Intronic
1099011594 12:77297577-77297599 TGGTTTTGCTGTAGAGGGAATGG + Intergenic
1099478408 12:83137084-83137106 AGCTTTTGTTGGAGAGGTAAAGG + Intergenic
1100159216 12:91838144-91838166 AAGTTTTGTTGCAGTGTGGGTGG + Intergenic
1103093820 12:118117228-118117250 AACTTTTGCTGCAGAAGTAAGGG + Intronic
1103571738 12:121849497-121849519 AAGTTTGGTTGCAGAGGCCATGG + Intronic
1103825053 12:123731414-123731436 TAGCTTTGATGCAGAGAGAATGG - Intronic
1105073969 12:133259268-133259290 AAGTTTTGCTGCAATGGGGATGG - Intergenic
1105073980 12:133259339-133259361 AAGTTTTGCTGCAATGGGGATGG - Intergenic
1105073991 12:133259410-133259432 AAGTTTTGCTGCAATGGGGATGG - Intergenic
1106624343 13:31405086-31405108 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1106638154 13:31553273-31553295 AAGTTTTGTAGGAAAGGGTAGGG - Intergenic
1107111526 13:36702984-36703006 AAGTTTAGTTGCAGTGAGGATGG + Intergenic
1107568105 13:41627567-41627589 AAGTTTTGTTGTAGTGTGGATGG - Intronic
1108490295 13:50975021-50975043 AAGTGTGGCTGCAGAGGGAAGGG - Intergenic
1109415702 13:62036701-62036723 CAGTTTTGTTGTAGGGGTAATGG + Intergenic
1109573709 13:64226027-64226049 TAGATTTGTTGCAGAGGCACAGG - Intergenic
1109581984 13:64352026-64352048 ACATTATGTTGCAAAGGGAATGG - Intergenic
1109742838 13:66577921-66577943 AAGTGCTGATGCTGAGGGAAAGG + Intronic
1109890942 13:68613666-68613688 AAGTTTTTTTGGAGGGGGAGGGG + Intergenic
1110438859 13:75505509-75505531 AAGTCTTGTGGCATATGGAAAGG - Intergenic
1112669077 13:101614006-101614028 AAGCTTTGTTGAATAGGGATAGG + Intronic
1113521384 13:110944148-110944170 AAGTTATGGTGAAGAGAGAATGG - Intergenic
1113811132 13:113143346-113143368 AAGTTTTCAGGCAGAAGGAATGG - Intronic
1113968506 13:114169339-114169361 AAGTTTTGTTGCAGTGAGGATGG + Intergenic
1114834117 14:26183220-26183242 AAGTCATATTGCAAAGGGAAGGG - Intergenic
1114912267 14:27215055-27215077 AAGTTTTGTTGTAGTGTGGATGG + Intergenic
1114919642 14:27310901-27310923 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1115543706 14:34446161-34446183 AAGTTTTGTTGTAGTGTGGATGG - Intronic
1115957627 14:38798864-38798886 GAGTTTTGTTGGAGAGGGACTGG + Intergenic
1116727173 14:48575620-48575642 AAGCTTTGTCTCAGAGGGACCGG + Intergenic
1119192490 14:72692615-72692637 TGGTTTTGTTGTAGAGGGGAGGG - Intronic
1120232203 14:81851978-81852000 AAGTTTTGTTGTAGTGTGCATGG + Intergenic
1120390983 14:83908517-83908539 AAGCTTAGTTGCAGTGGTAACGG + Intergenic
1121199230 14:92103891-92103913 AAGGTATATTGCAGAGGGGAAGG + Intronic
1121268209 14:92618470-92618492 AAGTTTTGTTGCAATGTGGATGG + Intronic
1122485974 14:102080150-102080172 AAGTTTTGTTGCGTACTGAAAGG - Intergenic
1122531508 14:102430828-102430850 AAGTTTCCTGGAAGAGGGAAAGG - Intronic
1126341076 15:47641775-47641797 ACGTTTTATGGCAGAGGGAGTGG - Intronic
1128483798 15:68065128-68065150 AAGTTTTTTTGCGGGGGGGATGG + Intronic
1128903169 15:71443748-71443770 AATGTATGTTGTAGAGGGAATGG - Intronic
1129760801 15:78128352-78128374 AACTTTGGGTGCAAAGGGAAAGG + Intronic
1129927894 15:79382494-79382516 AAGTTCTGTTGCAAAGGGAGAGG + Intronic
1130136014 15:81182653-81182675 AGATTTTCTGGCAGAGGGAAAGG + Intronic
1130891904 15:88140504-88140526 TAGTTTTGTTTGAGAGTGAATGG - Intronic
1131533232 15:93212591-93212613 AAGTGGTGTTGCTGAGTGAAAGG + Intergenic
1131857924 15:96618389-96618411 TTCTTTTGTTGCAGAGGAAAGGG + Intergenic
1133429306 16:5722843-5722865 AAGTTAAGTGGCAGAGGGTAGGG - Intergenic
1133846633 16:9460327-9460349 ATGTTTAATTGAAGAGGGAAGGG + Intergenic
1135604144 16:23808696-23808718 CAGTTTTGTTACATAGGTAAAGG - Intergenic
1137353211 16:47732747-47732769 AACTTTTTTTGCAGGGGGCAGGG + Intergenic
1137999789 16:53264777-53264799 AAGCTTTGAGGCAGAGGGAATGG + Intronic
1141834043 16:86526670-86526692 ACGTTGTGTTCCAGAGGGAAGGG - Intergenic
1143701496 17:8663907-8663929 CAGTCTGGTTCCAGAGGGAAAGG + Intergenic
1143921239 17:10332471-10332493 AAGTTTGCTTTCAGAGGAAATGG + Intronic
1144061654 17:11588297-11588319 AAGATTTGTAGCAGAAAGAAGGG - Intergenic
1144426627 17:15148992-15149014 AAGTTTTGTTGCAGTGTGTATGG - Intergenic
1147872459 17:43597238-43597260 AAGCTTTGATGAAGAGGGAAAGG - Intergenic
1148004259 17:44412848-44412870 ATGTTTTGTTGTAGAGGGAGGGG - Intronic
1150483606 17:65529236-65529258 ATGATCTGTTGCAGAGGGAGAGG - Exonic
1151995939 17:77609308-77609330 AAGTTTTGCTGCCAAGGAAAGGG + Intergenic
1152461627 17:80445023-80445045 AAGGTTTGTGGCAGAGGGTCTGG - Intergenic
1153235603 18:2984056-2984078 AAGTTTAGATGCAGAGAAAAGGG - Intronic
1153741950 18:8138470-8138492 AAGTTGTCTAGAAGAGGGAAGGG - Intronic
1154267526 18:12892027-12892049 AAACATTTTTGCAGAGGGAATGG + Intronic
1154394583 18:13975369-13975391 AAGTTGTGCAGCAGAGGAAAGGG - Intergenic
1155373006 18:25123605-25123627 CAGTTTCCTTGCAGAGGGAAGGG + Intronic
1155381672 18:25229347-25229369 AAGCTTTGTTGCAGTGGGCAAGG - Intronic
1155636165 18:27957882-27957904 AATTTTTGATGCAGAAGGAGTGG + Intronic
1156754604 18:40506734-40506756 CAGTATTGCTGCAGTGGGAATGG + Intergenic
1158557663 18:58488694-58488716 AAGTTTTAACGCATAGGGAAAGG + Intronic
1158643366 18:59221198-59221220 AGGACCTGTTGCAGAGGGAATGG - Intronic
1163792535 19:19316162-19316184 CAGCTGTGGTGCAGAGGGAAGGG - Intronic
1164461289 19:28450949-28450971 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1164644593 19:29849018-29849040 AAGTATTTTTACAGAGGGCAGGG + Intergenic
1164677688 19:30112657-30112679 GAGCCCTGTTGCAGAGGGAAGGG + Intergenic
926374492 2:12212959-12212981 TTGTTATTTTGCAGAGGGAAGGG + Intergenic
927520378 2:23694801-23694823 AAGAGGTTTTGCAGAGGGAATGG - Intronic
928382581 2:30832437-30832459 AAGTTTTGTTGCAGTGTGGATGG - Intergenic
928518982 2:32069526-32069548 AAGTCATGTTGCCAAGGGAATGG - Intronic
928824578 2:35404585-35404607 AAGTTTTGTAGCAGTGGAAGTGG + Intergenic
928926526 2:36585467-36585489 AATTTTTATTGCAGAGAGCATGG + Intronic
930205912 2:48586613-48586635 AAGTTTTGGGGCTGAGGGAGTGG + Intronic
931313088 2:61101090-61101112 AAGTTTTATTGGTGAGGTAATGG + Intronic
933193100 2:79359130-79359152 AACTTTTGATACAGAGGGAGTGG + Intronic
933271462 2:80237657-80237679 AAGTCTTGTTGCCCAGGGTAGGG - Intronic
935323299 2:101909562-101909584 ACGTTTGGTTGTAGAGGGAAAGG - Intergenic
938051800 2:128179868-128179890 AAGGTTTGTTTCACAGAGAAAGG + Exonic
939107178 2:137962881-137962903 TATTTTTTTTGCAGAGGGACTGG + Intergenic
940569243 2:155409424-155409446 AAGTTTTGTTGTAGTGCGGATGG - Intergenic
941638141 2:167958483-167958505 GAGTTTTCTTGCAGTGGGTAGGG - Intronic
942218302 2:173744353-173744375 TAGCTATGTTGCAGAGAGAAGGG - Intergenic
942449801 2:176101649-176101671 AAGCTCTGTTGCACAGGGAGAGG + Intergenic
942599740 2:177628681-177628703 AAGTTTTCTCCCAGAAGGAATGG - Exonic
942818839 2:180086244-180086266 AAATTGTGTTGGAGAGAGAATGG - Intergenic
942911402 2:181248361-181248383 ATGTTTTCTTGATGAGGGAAAGG - Intergenic
943969179 2:194381290-194381312 AAGTTTTATTGCAGTAGGGATGG + Intergenic
945096626 2:206225945-206225967 ACCTTTTGTTGCAAAGGGAATGG - Intergenic
946029093 2:216691001-216691023 AAGACTTGTTTCAGAGGGAGGGG + Intronic
946444535 2:219727049-219727071 AAGTGCTACTGCAGAGGGAAAGG + Intergenic
946960991 2:224985746-224985768 AAGATTTGTTGAAGAAGGATGGG - Intronic
947085772 2:226450721-226450743 AGTTTTTATTGCAGAGGTAAAGG - Intergenic
947691927 2:232146294-232146316 ATTTTCTGTTGCAGAGTGAATGG + Intronic
948789304 2:240369186-240369208 AAGTTTGGTTGCACAGACAAGGG - Intergenic
948985807 2:241522445-241522467 ATGTTGTGGTGCAGAGGGAAGGG - Intergenic
1169983052 20:11408632-11408654 AGGTCTTGTTGTAGAGGGGATGG - Intergenic
1170373033 20:15670125-15670147 ATGTTTTCTTGCAGAGAAAATGG + Intronic
1170548537 20:17455657-17455679 TAGTTTTGTTGCATTGGGACTGG - Intronic
1171469345 20:25357332-25357354 ATGTTTTGTTGCAGACAGAAGGG - Intronic
1172739924 20:37158335-37158357 AAGCTTTCAAGCAGAGGGAAGGG - Intronic
1172902153 20:38343259-38343281 AAGTTTTAAAGCAGAGGCAAAGG + Intergenic
1173769302 20:45644514-45644536 AATTTTTTTTGTAGAGGGCATGG + Intergenic
1173801676 20:45898232-45898254 AAGTTTTTTTGGAGAGGGGTGGG + Intronic
1174563463 20:51447560-51447582 AAGTGATGTGGCAGCGGGAAAGG - Intronic
1174630768 20:51955067-51955089 AAGTTTTCTTGCAGTGTGGATGG - Intergenic
1175878676 20:62243862-62243884 AATTTTTTTTGCAGAGGGTAGGG + Intronic
1177534011 21:22401203-22401225 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1178026508 21:28474486-28474508 CAGTTTTAGTGCAGAGGGCACGG - Intergenic
1179246033 21:39635030-39635052 CAGTTTTGTTGCAGATGGCATGG - Intronic
1180848729 22:18999441-18999463 AGGTTTTCAGGCAGAGGGAAGGG - Intergenic
951187160 3:19727177-19727199 AAGTTTTGTTGCAGTGTGGATGG - Intergenic
951841613 3:27039955-27039977 AAGTTTTGTTGTAGTGTGGATGG + Intergenic
953807332 3:46082034-46082056 AAGTTTAGTGGCACAGGGATTGG - Intergenic
954976703 3:54702598-54702620 ATGTTAGGTTGCAGAGGAAAAGG + Intronic
955926518 3:64011381-64011403 AAGATATGTTAGAGAGGGAAAGG - Intronic
956359061 3:68427442-68427464 CAGTGTTGTTGCAGAAGGACAGG - Intronic
956593435 3:70941629-70941651 AAGTGTTGTGGCAGGGGAAAGGG - Intergenic
957603493 3:82369065-82369087 CAGTTTTGTTGCAGTGTGGACGG + Intergenic
957750824 3:84413047-84413069 AAGTTTTGTTGCACTGTGGATGG - Intergenic
958069544 3:88592709-88592731 ACTTTTTGTTGTAAAGGGAAGGG + Intergenic
959609264 3:108276037-108276059 TAGTTTTGTGGGAGGGGGAAGGG + Intergenic
959669696 3:108962347-108962369 AAATTTTTTTGAAGTGGGAAGGG + Intronic
960249451 3:115436208-115436230 AAGTTAAGTTTCAGAGGGCACGG + Intergenic
960737349 3:120795145-120795167 AATCATTGTAGCAGAGGGAAGGG - Intergenic
960861194 3:122154928-122154950 GAGTTTGCTTTCAGAGGGAAGGG - Intergenic
961440528 3:126950182-126950204 AAGTTTTGTCATTGAGGGAAGGG + Intronic
962498741 3:135967509-135967531 AAGTTTTGTTTCAGCGAGAAAGG + Intronic
962853503 3:139325131-139325153 TAGTTGGGTTGGAGAGGGAATGG + Intronic
962856538 3:139351144-139351166 AAGTTTTGATACAGGGGAAAGGG + Intronic
963381263 3:144533427-144533449 AAGTTCTTTTGCAGAGGGGTTGG - Intergenic
963735307 3:149012026-149012048 ATATTTTCTGGCAGAGGGAAGGG - Intronic
963932557 3:151018956-151018978 AAGTTTTGTTGAATAAGGAAAGG - Intergenic
965096122 3:164228240-164228262 AAGTTTTGCTGCAGTTTGAATGG + Intergenic
965278726 3:166721182-166721204 AAGTTTTGTTGCAGTATGGATGG + Intergenic
965429053 3:168564173-168564195 AAGCTTTGTTGCAGTGTGAGTGG + Intergenic
966536258 3:181037599-181037621 AAGTTTTGTTGCAGGGTGGATGG + Intergenic
968384099 4:121383-121405 AAGTTTAGATGTAGAGGGAATGG - Intergenic
968847058 4:3049628-3049650 AAGTTTTGTTGCAGTGCGGATGG + Intergenic
969432973 4:7166792-7166814 AAGTTTTGCTCCCGAGGGAAAGG + Intergenic
971213549 4:24642534-24642556 AAGTTTTGTTGTAGTGTGGATGG + Intergenic
971296681 4:25400128-25400150 GAGTTTTGCTGTAAAGGGAATGG + Intronic
971613062 4:28751084-28751106 AAGGTTTTTCTCAGAGGGAATGG + Intergenic
971650734 4:29269958-29269980 GAGTTTTGTGGCAGAGTGGATGG - Intergenic
972049803 4:34715367-34715389 TAGTTTTGAGGGAGAGGGAAGGG - Intergenic
972532088 4:39970627-39970649 CAGTTTAGTGGCAGAGGGCAGGG - Intronic
972565588 4:40266247-40266269 AAGTTTGGTGGAAGAGGGAAGGG - Intergenic
974365958 4:60949126-60949148 AATTTTTGTTGCAGAGTACAGGG - Intergenic
974523127 4:63011493-63011515 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
975140927 4:70917564-70917586 AAGTTTTGTTGTAGTGTGGATGG + Intronic
975269625 4:72416484-72416506 GAGGTTTGTTCCAGAGGGTATGG - Intronic
975489253 4:74970483-74970505 TAGCTGTGTGGCAGAGGGAAGGG + Intronic
975659170 4:76671330-76671352 AAGTTTTTAAGCAGAGGGACAGG - Intronic
975755114 4:77564266-77564288 AAGATTTGCTGCAGAGAGAGTGG + Intronic
975905655 4:79208968-79208990 AAATTTTGTTCCAGAAGCAAAGG - Intergenic
978721315 4:111913310-111913332 AAGTTTTATTTCAGAGAAAAAGG + Intergenic
979217910 4:118187882-118187904 AAGTTTTGCTGCAGTGTGGATGG + Intronic
979620559 4:122794451-122794473 AAGTTTTGCTGCAGTGTGAGTGG - Intergenic
979942003 4:126772843-126772865 AAGTGTTGTGGGATAGGGAATGG + Intergenic
980244837 4:130225180-130225202 GAATTTTGTTACTGAGGGAAGGG + Intergenic
980669531 4:135986407-135986429 GAGTGTTGTTGAATAGGGAAAGG - Intergenic
982207622 4:153008796-153008818 AACTTGAGTTGCAGAGGAAATGG + Intergenic
982827750 4:160021836-160021858 GAGTTTTGTTGAAGAGAGGAGGG + Intergenic
983473462 4:168185184-168185206 AAGTTCTGTCGCTGAGGTAAAGG - Intronic
983537598 4:168874836-168874858 AAGTTTTGATACTGAAGGAAAGG - Intronic
983628078 4:169823613-169823635 AGGTTTTGTGGCAGAGGACATGG - Intergenic
983783690 4:171705313-171705335 AATTTTTGTTACAGAGCCAAGGG - Intergenic
983954419 4:173680406-173680428 AAAGTTTCTGGCAGAGGGAACGG + Intergenic
984894836 4:184529088-184529110 TATTTTTGTTGCATAGGTAACGG + Intergenic
985497168 5:215689-215711 AAGTTTTGCTGTAGAGGAAGAGG - Intronic
985738407 5:1599262-1599284 AAGTTTTGCTGTAGAGGAAGAGG + Intergenic
986643649 5:9895352-9895374 AACTTCTGTTTCAGAGGAAATGG + Intergenic
986741585 5:10710143-10710165 TTGTTTTGTAGCCGAGGGAAGGG - Intronic
986948555 5:13053330-13053352 AAATTTTGTTCCAGAGGGAGGGG - Intergenic
988361728 5:30244626-30244648 GTGTTTTGTTTCAGATGGAAAGG + Intergenic
988568020 5:32335983-32336005 AAGTTTTGTTGCAGTGTGGATGG + Intergenic
988809594 5:34771326-34771348 AATATTGGTTGCAGAGGCAATGG + Intronic
990290822 5:54349646-54349668 AAGTTTTGCTGTAGTGTGAATGG - Intergenic
990650949 5:57898796-57898818 AAGATTTGATGAAAAGGGAAAGG + Intergenic
990667656 5:58091897-58091919 AAGTTTTACTGCAGAGGGGAGGG + Intergenic
991499282 5:67260007-67260029 AAGTTTTGTTGCACAGGAAATGG + Intergenic
991573970 5:68083516-68083538 AAGTGTTGATGTAGTGGGAAGGG - Intergenic
991653962 5:68884247-68884269 CAGTTTTGTTTCAGAGAGAGAGG - Intergenic
991658413 5:68926410-68926432 ATGATTTGTTTCAGAGGAAAAGG + Intergenic
992136762 5:73753501-73753523 AAGTTTTCTTGCTGTGGGAAGGG + Intronic
992349503 5:75914535-75914557 AGCATTTGTTACAGAGGGAATGG + Intergenic
992437199 5:76766199-76766221 AAGTGGTGTTGCAGAGGGAATGG + Intergenic
993248742 5:85487153-85487175 TAGTTTTGTTGCAGTGTGTATGG - Intergenic
993745244 5:91589137-91589159 AAGTTTTGTTGCAGTGTGAATGG + Intergenic
994467709 5:100159538-100159560 AAGTTTTGCTGCAGTGTGGATGG + Intergenic
995578436 5:113568408-113568430 CAGTTTTGTTGCATAGGTAAAGG + Intronic
996053040 5:118953433-118953455 AAATTTTCATGCAGGGGGAAGGG - Intronic
998256822 5:140594534-140594556 AAGTTTTGTTCCTGTGGGCAGGG + Intergenic
1003553115 6:7116321-7116343 AATTTTTATTGCTGAAGGAAGGG - Intronic
1004765875 6:18726281-18726303 AAGTTTTGTTGCAGTGTGGATGG - Intergenic
1005639364 6:27781320-27781342 AAGTTTTGTTGTAGTGTGAATGG - Intergenic
1006415879 6:33903644-33903666 AAGGTTGGTGGTAGAGGGAACGG - Intergenic
1007119175 6:39366193-39366215 AAGTGGTGTTGCGCAGGGAATGG - Intronic
1007468635 6:42073618-42073640 GAGTGTTCTGGCAGAGGGAATGG + Intronic
1008188685 6:48427006-48427028 AAGTTTTCTTGCAGAGCGAAGGG - Intergenic
1008819549 6:55613878-55613900 AAGGTTTGTTCCATAGGTAAAGG - Intergenic
1010100483 6:72100347-72100369 AAACTTTATTGCAGAAGGAATGG + Intronic
1010511906 6:76730193-76730215 AAATTGAGTTCCAGAGGGAAGGG + Intergenic
1010535852 6:77029271-77029293 AAGATATGTTACAAAGGGAAGGG - Intergenic
1011341813 6:86324338-86324360 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1011440763 6:87384608-87384630 GAGTTTCCCTGCAGAGGGAAAGG + Intronic
1011712235 6:90066459-90066481 AAGTTTGGTGGCAGACGGTAGGG + Intronic
1012739732 6:103000935-103000957 TAGTTTTGTGGGAGGGGGAAGGG + Intergenic
1012758192 6:103260405-103260427 CAGTTTTGTTGCTTAGAGAAAGG - Intergenic
1012808632 6:103928600-103928622 AAGTTATGTTGCAAAAAGAATGG + Intergenic
1013194220 6:107831348-107831370 AAGTTTTGTTCTAAAGGCAATGG - Intergenic
1013411259 6:109886012-109886034 AAGTTTTGCTGCAGTGTGTATGG - Intergenic
1014491711 6:122070800-122070822 AAGTTTTGTGGTGGAGAGAATGG - Intergenic
1014640621 6:123905068-123905090 AACTTTTTTTGCAAAGGGAATGG - Intronic
1016304530 6:142669896-142669918 AACTTTCCTGGCAGAGGGAATGG - Intergenic
1017378544 6:153799315-153799337 AAGTTTTGTTGTAGTGTGGATGG + Intergenic
1017526036 6:155242090-155242112 CAGGTTTCTTGCAGAGAGAAGGG - Intronic
1017922325 6:158883236-158883258 AAGCTCTGTTGCAAAGGGTAGGG + Intronic
1017972469 6:159325261-159325283 AAGCTTTTTGGCACAGGGAAAGG + Intergenic
1019082687 6:169445931-169445953 CAGCTCTGTTGCAGAGGGAGGGG - Intergenic
1020564323 7:9777029-9777051 ATGTATTGTTTCACAGGGAATGG + Intergenic
1020790026 7:12615868-12615890 AAGTTTTGTTTCAATGGCAAGGG - Intronic
1021355178 7:19645205-19645227 ATCTTTTGTTGCAGAGACAAGGG - Intergenic
1021868074 7:24978923-24978945 AAGTTGCGTTGCCGAAGGAAGGG + Intronic
1024242789 7:47448279-47448301 AAGTTTTGTTGCAGAGGGAATGG - Intronic
1024328658 7:48134356-48134378 AAGTTTTGTTGTAGTGTGGATGG + Intergenic
1024418658 7:49137269-49137291 AAGTTTAGTTGAAGAGGAGAGGG - Intergenic
1024549105 7:50545960-50545982 AAGTTTTGTAGATGAGGAAATGG + Intronic
1024599629 7:50969381-50969403 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1024997400 7:55282931-55282953 AAGTTTTGTTGCAGTGTGGATGG + Intergenic
1025978024 7:66384980-66385002 AATTTTTTTTGCAGAGTGAGGGG + Intronic
1027675267 7:81149626-81149648 AAGTGTAGTTGGAGGGGGAATGG + Intergenic
1027707577 7:81553776-81553798 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1028444901 7:90910817-90910839 CAGGTTTGTTGCATAGGTAAAGG + Intronic
1029810850 7:103046897-103046919 AAGTTTTGTTGCAGTGTGGATGG + Intronic
1030429800 7:109430861-109430883 AAGTTATTTTGGAGAGGAAAAGG - Intergenic
1030601675 7:111600248-111600270 AAGTTTTTGAGCAGAGGGCATGG + Intergenic
1030643268 7:112030018-112030040 AAGTTTTCATGCAGATGTAATGG - Intronic
1030741180 7:113111578-113111600 AATTTTTGTGGCAGAATGAAAGG + Intergenic
1031305340 7:120119185-120119207 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1031624930 7:123981609-123981631 AAATAATGTTGCAGGGGGAAAGG - Intergenic
1032274046 7:130439347-130439369 AAGTTTTTTTGCAGGGGGGAGGG + Intronic
1032756181 7:134892889-134892911 AAGTTTTGATGAAGAGGGTGGGG - Intronic
1033296085 7:140137024-140137046 AAGCTTAATAGCAGAGGGAAAGG + Intronic
1033942434 7:146672217-146672239 AAGATTTGCTGAAGAGTGAACGG - Intronic
1035494734 7:159314484-159314506 AAGTTTTGCTGCAATGGGGATGG - Intergenic
1036550885 8:9814336-9814358 AAGTCCTCTTGCAGTGGGAATGG - Intergenic
1037043292 8:14264455-14264477 ATGTTTTGTTCCTGAAGGAAGGG - Intronic
1038197274 8:25379927-25379949 AAGTCTGGTTGGAGGGGGAAGGG - Intronic
1040683998 8:49848354-49848376 AAGATTGGATGCAGAGAGAATGG + Intergenic
1041242608 8:55861169-55861191 CCGTTTTGTAGCAGAGGAAATGG - Intergenic
1043827038 8:84941795-84941817 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1044032597 8:87256861-87256883 AAGTTTTGCTGTAGTGTGAATGG + Intronic
1044043124 8:87395358-87395380 AAGTTATGGAGAAGAGGGAAGGG + Intronic
1045799506 8:106086232-106086254 AAATGTTGATGCAGATGGAATGG - Intergenic
1046612622 8:116442591-116442613 AAGCTTTGTTTTAGAGGGGAAGG - Intergenic
1046863962 8:119125433-119125455 AAATGGTGGTGCAGAGGGAAAGG - Intergenic
1046880191 8:119299143-119299165 AAGTTTTCTTGCAGGGGCAGAGG - Intergenic
1046881440 8:119312853-119312875 CAGTTTTGTTACATAGGTAAAGG - Intergenic
1046996952 8:120534248-120534270 AAGTTTTGTTGTAGTGTGGATGG - Intronic
1047833521 8:128662094-128662116 TAGAATTGTTGCAGATGGAAAGG + Intergenic
1048442190 8:134468240-134468262 AAGTGTTATTTCAGATGGAATGG - Intergenic
1048559694 8:135520481-135520503 AATTTATGTTCCAGAGGGAGAGG + Intronic
1048896380 8:138996203-138996225 AAACTTTGTTGCACAGGGAATGG - Intergenic
1050124120 9:2338842-2338864 AATTTCTGTAGCAGTGGGAAGGG - Intergenic
1050391394 9:5147402-5147424 AGGTTCTGCTGCAGAGGCAATGG + Intronic
1051086260 9:13352373-13352395 AAGTTTTGTTAGAGAAGGGAAGG + Intergenic
1052388937 9:27855731-27855753 AAGTTTAGTTGAGGAGGGACAGG + Intergenic
1052768562 9:32666717-32666739 AAGTTTTGTTGCAGGCTGCAGGG + Intergenic
1053211255 9:36230383-36230405 GAGTTCTGGTGAAGAGGGAAGGG - Intronic
1054957823 9:70933635-70933657 AAGTTTTGTTACAAAGGAAAAGG + Intronic
1055295913 9:74833348-74833370 AAGTATTCTTTCAAAGGGAACGG - Intronic
1056034045 9:82585003-82585025 AGGTTTGGATGCAGAGAGAATGG - Intergenic
1056249579 9:84733987-84734009 CAGCTTTGCTGCAGTGGGAAGGG + Intronic
1056430240 9:86520223-86520245 AAGTTTTGTTGCAGTGTGGATGG - Intergenic
1056504261 9:87241884-87241906 AGTTTTTGTGGCAGAGGAAAAGG - Intergenic
1058046575 9:100363899-100363921 AAGTTTTGCTGCAGTGTGAGTGG - Intergenic
1058168530 9:101649852-101649874 ATGTTTTGTTCCAGAGACAAGGG - Intronic
1058264889 9:102886867-102886889 AAGTTTTTTTGCAGTGGGGTAGG + Intergenic
1058427089 9:104884528-104884550 AAGTGTTCCTGCAGAGGGCATGG + Exonic
1060329703 9:122655785-122655807 CAGTTTTGTTACATAGGTAAAGG - Intergenic
1060756027 9:126214384-126214406 AAGTTTTGCTACAAATGGAAGGG - Intergenic
1061430020 9:130524844-130524866 AAGTTTTCTTGTAGAGGTGATGG - Intergenic
1186132157 X:6479446-6479468 AAGAATTGTATCAGAGGGAAGGG - Intergenic
1186641949 X:11465116-11465138 AAGTTCTGTAGAAAAGGGAAGGG - Intronic
1189001574 X:36953511-36953533 AAGTTTTGCTGCAGTGTGGATGG - Intergenic
1189055870 X:37698974-37698996 AAGCTTTATTCCAGAGGCAATGG + Intronic
1189601335 X:42629948-42629970 CAGTTTTGTTACAGAGTGGATGG + Intergenic
1191637943 X:63398019-63398041 AAGTTTTGCTGCAGTGTGGATGG + Intergenic
1191668756 X:63729815-63729837 AAGTTTTGTTGATGTGGGAGTGG - Intronic
1192465934 X:71356019-71356041 AAGCTTTTTTTCAGAGGGATTGG - Intergenic
1192716811 X:73651480-73651502 AAGTTTTGTGGCTGAGACAATGG - Intronic
1193476966 X:81978220-81978242 AGGTTTTGTTGCAGTGCGGATGG - Intergenic
1193695752 X:84705824-84705846 AAGTTTTGCTGCAGTGTGAATGG + Intergenic
1194051559 X:89075450-89075472 GAGTTTTGTTGCAGTGTGAGTGG + Intergenic
1194138241 X:90174739-90174761 AAGTTTTGCTGCAGTGTGAATGG + Intergenic
1195488574 X:105439486-105439508 AAGTTATATTGTAAAGGGAACGG - Intronic
1195708460 X:107755540-107755562 ATGTTTTGTATCACAGGGAATGG + Intronic
1196542628 X:116926942-116926964 AAGTTTTGTTGGAGTGTGGATGG + Intergenic
1196698906 X:118644898-118644920 AAGTTGTGTTGAAGAAGGATTGG + Intronic
1197934411 X:131726101-131726123 AAGTTTTGTTGTAGTGTGGATGG - Intergenic
1198821686 X:140654880-140654902 GTGTTTTTTTGCATAGGGAATGG - Intergenic
1198990626 X:142510276-142510298 AAGTCTTGTGGCAAAGGGTAAGG + Intergenic
1199233573 X:145466940-145466962 AAGTTTTGCTGCAGTGTGGATGG + Intergenic
1200484038 Y:3744979-3745001 AAGTTTTGCTGCAGTGTGAATGG + Intergenic
1200734312 Y:6777393-6777415 AAGTTTTGTTGTAGAGTGGATGG + Intergenic
1200877216 Y:8170277-8170299 AAGTTTTGTTGCAGGGACACAGG + Intergenic
1201355521 Y:13093207-13093229 AGGTTTTTTTGCAGGGGAAATGG + Intergenic
1201893125 Y:18964438-18964460 AAGTTGTCTTGCAAAGGGTATGG - Intergenic