ID: 1024242790

View in Genome Browser
Species Human (GRCh38)
Location 7:47448284-47448306
Sequence CAAGGAAGTTTTGTTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 235}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242790_1024242803 23 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242803 7:47448330-47448352 CATGGGATCCTCCCCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 191
1024242790_1024242796 5 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242796 7:47448312-47448334 CACGACGTCCCAGGGAGACATGG No data
1024242790_1024242801 21 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242801 7:47448328-47448350 GACATGGGATCCTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 129
1024242790_1024242804 26 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242804 7:47448333-47448355 GGGATCCTCCCCAGGTGGGGTGG 0: 1
1: 0
2: 2
3: 15
4: 238
1024242790_1024242797 6 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242797 7:47448313-47448335 ACGACGTCCCAGGGAGACATGGG No data
1024242790_1024242802 22 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242802 7:47448329-47448351 ACATGGGATCCTCCCCAGGTGGG 0: 1
1: 0
2: 6
3: 12
4: 129
1024242790_1024242793 -4 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242790_1024242794 -3 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242794 7:47448304-47448326 TTGAAGTCCACGACGTCCCAGGG No data
1024242790_1024242805 27 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242805 7:47448334-47448356 GGATCCTCCCCAGGTGGGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 193
1024242790_1024242800 18 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242800 7:47448325-47448347 GGAGACATGGGATCCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242790 Original CRISPR CAAGGAAGTTTTGTTGCAGA GGG (reversed) Intronic
901909428 1:12443786-12443808 AAAGGAAGTTCTTTAGCAGAAGG - Intronic
908383266 1:63616533-63616555 CAAGAAACTTTTGGTGCAGAAGG - Intronic
909404953 1:75277856-75277878 CACAGAAGTTGTGCTGCAGATGG + Intronic
910399964 1:86828569-86828591 TTAGGAAGTCTAGTTGCAGATGG + Intergenic
911637430 1:100250162-100250184 CAAGAAAGTTATGTTGCAGTAGG + Intergenic
913609581 1:120497111-120497133 CCAGGAAGTTCTGCGGCAGAAGG - Intergenic
913638026 1:120783986-120784008 AATTAAAGTTTTGTTGCAGAGGG + Intergenic
914280684 1:146168996-146169018 AATTAAAGTTTTGTTGCAGAGGG - Intronic
914541727 1:148619936-148619958 AATTAAAGTTTTGTTGCAGAGGG - Intronic
914581609 1:149024733-149024755 CCAGGAAGTTCTGCGGCAGAAGG + Intronic
914624912 1:149451311-149451333 AATTAAAGTTTTGTTGCAGAGGG + Intergenic
914972318 1:152318922-152318944 AAAGGAGGTTTTGTGGTAGAGGG + Intronic
916674278 1:167053271-167053293 CAAGGGAGCTTGCTTGCAGATGG - Exonic
917310197 1:173670448-173670470 CAGGGAAGTTTTTGTGCTGAAGG + Intergenic
918439905 1:184556385-184556407 GAAGGAAGTTCTGTTCCAGAAGG + Intronic
918792558 1:188847526-188847548 CCAGGAAGTTTAGTTTCAGAAGG - Intergenic
919789212 1:201279518-201279540 CCAGGAAGTTCAGTTGCAGACGG + Intergenic
920159830 1:203988088-203988110 CAAGGAAGTTTTCCTGCCCAGGG + Intergenic
920823023 1:209399056-209399078 CAAGGAAATTTTGTTTTGGAAGG - Intergenic
921668080 1:217896442-217896464 TAAGAAACTTTTGTAGCAGAAGG + Intergenic
924060747 1:240171552-240171574 CAATGAAATTTTCTTGCATATGG + Intronic
924394122 1:243599227-243599249 AAAGGAAGTTTTTATGCAAAAGG + Intronic
1064963866 10:20995667-20995689 CAAGGATGTTTTGATGTGGAGGG - Intronic
1067818143 10:49499178-49499200 CAAGGAAGTTATATTGAAGCAGG - Intronic
1068369540 10:56095405-56095427 CCTGGAAGCTTCGTTGCAGAGGG + Intergenic
1068518900 10:58057537-58057559 TTAGGAAGTTTTGTTACAGTAGG - Intergenic
1070253557 10:74794678-74794700 CAAGAAAATCATGTTGCAGAAGG - Intergenic
1070493666 10:77000902-77000924 CAACAGAGTTTTGATGCAGATGG - Intronic
1070589538 10:77791983-77792005 CAAGGTCGTTTTGCTGAAGACGG + Exonic
1072490471 10:95900594-95900616 GAAAGAAGTATTATTGCAGAAGG - Intronic
1073854099 10:107655298-107655320 CAAGGAAGGTTTTAAGCAGATGG + Intergenic
1074365182 10:112852301-112852323 CTAGGAAGTTTTGTGGGGGAAGG - Intergenic
1074531720 10:114302909-114302931 CCAGGAAGTCTTGTTGTATATGG - Intronic
1074775232 10:116763116-116763138 TAAAGAAGTTTTGTTGCTGATGG + Intergenic
1075947766 10:126453105-126453127 GAAAGAAGATTTGTTGGAGAAGG + Intronic
1076746244 10:132516139-132516161 CAAGGAGGCTTTGTAGTAGATGG - Intergenic
1078470960 11:11586361-11586383 CAAGGGAGTTTTGTTGCTATAGG - Intronic
1080478087 11:32616927-32616949 CAAGGAAGGTTTCTTGGAGAAGG + Intronic
1080711088 11:34748640-34748662 CAAAGAAGTTTTGTTGAGGCTGG - Intergenic
1081712294 11:45225071-45225093 AAAGGAAGTTCCGCTGCAGAAGG + Exonic
1083466821 11:62852925-62852947 AGAGGAAGATTTGTTCCAGAAGG - Intergenic
1083735967 11:64681481-64681503 CAAGGAAGGCTTTTTGAAGAAGG + Intronic
1085787552 11:79468208-79468230 CAAGGAAGTTATGTTAAAAACGG + Intergenic
1086345846 11:85895336-85895358 CAAGGAAACTTTGTTGCAACTGG + Exonic
1090837722 11:130465462-130465484 ATAAGAAGTTTTGTTTCAGATGG - Intronic
1090886740 11:130883758-130883780 CAAGAAAGATTTGTTGCACTTGG - Intronic
1091297330 11:134483153-134483175 AAAGGAAGCTTTGATGGAGATGG - Intergenic
1095867900 12:46992581-46992603 TCAGGAAGTTTTGTCTCAGAGGG - Intergenic
1099246418 12:80198065-80198087 CAAGGAAGATTTGTGGGAGCAGG + Intergenic
1099648403 12:85391509-85391531 CAAGGAAGTTTTAATCAAGAAGG - Intergenic
1101092859 12:101305344-101305366 CAATGAATATTTGTTGCATAAGG + Intronic
1104246505 12:127047471-127047493 CAGGGAAGATATGTTGGAGAAGG + Intergenic
1105662617 13:22515202-22515224 CTATGAAGTTTTGTTGTAGATGG - Intergenic
1106209620 13:27629787-27629809 AAAGCAAGTTCTGTAGCAGATGG + Intronic
1108361485 13:49671984-49672006 CAAAGAAGGTTTCTTGAAGAAGG - Intronic
1108973989 13:56413231-56413253 CAAAGAATTTTTATTGCAAAAGG + Intergenic
1109762896 13:66853552-66853574 CAAGGAAACATTGTTGTAGAAGG + Intronic
1110060699 13:71034337-71034359 CTTGGAAGTTCTGTGGCAGAGGG - Intergenic
1111497587 13:89072490-89072512 AGAGTAAGTTTTCTTGCAGAAGG + Intergenic
1111675307 13:91379731-91379753 CAGGGAAGTTTTGTACTAGAGGG - Intergenic
1115322235 14:32094815-32094837 CCAGGAAGCTTCTTTGCAGATGG + Intronic
1115768839 14:36649198-36649220 CAATAAAGTTTTATTGCAAAAGG - Intergenic
1116595325 14:46835326-46835348 CTAGAAAGTTATGTTGCAAATGG + Intergenic
1116704317 14:48277360-48277382 TAAGGAATTTAGGTTGCAGATGG - Intergenic
1119148969 14:72340883-72340905 CCAGAAAGTTATGTTCCAGAGGG + Intronic
1119457078 14:74764664-74764686 CAAATAGATTTTGTTGCAGAGGG + Intronic
1119829677 14:77690567-77690589 CAAGGCAGTTGTGATGGAGATGG + Intronic
1125348403 15:38742587-38742609 CAAGAAAATTATGCTGCAGAGGG - Intergenic
1127443019 15:59030494-59030516 CAAATATGTTTTGTTGCTGAAGG + Intronic
1132158425 15:99513944-99513966 CAAGGAAGAGATTTTGCAGAGGG - Intergenic
1134494808 16:14724494-14724516 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1134500191 16:14763614-14763636 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1134526733 16:14950226-14950248 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1134545673 16:15106122-15106144 CAAAGAGGCTTTCTTGCAGAAGG + Intronic
1134580388 16:15365436-15365458 CAAAGAGGCTTTCTTGCAGAAGG + Exonic
1134714311 16:16348703-16348725 CAAAGAGGCTTTCTTGCAGAAGG - Intergenic
1134722186 16:16392067-16392089 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1134945241 16:18319802-18319824 CAAAGAGGCTTTCTTGCAGAAGG + Exonic
1134952505 16:18359955-18359977 CAAAGAGGCTTTCTTGCAGAAGG + Intergenic
1136150457 16:28344555-28344577 CAAAGAGGCTTTCTTGCAGAAGG + Exonic
1136166694 16:28458393-28458415 CAAAGAGGCTTTCTTGCAGAAGG + Exonic
1136196281 16:28656639-28656661 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1136212622 16:28770764-28770786 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1138292076 16:55856376-55856398 CCAGGATGTTTTGTATCAGATGG + Exonic
1138538888 16:57676230-57676252 GAAGGAAGGTTTGACGCAGAAGG + Exonic
1139855699 16:69978084-69978106 CAAAGAGGCTTTCTTGCAGAGGG + Intergenic
1140193810 16:72840070-72840092 CAAGTCAGTTTTGATTCAGAAGG - Intronic
1140367034 16:74390001-74390023 CAAAGAGGCTTTCTTGCAGAAGG - Exonic
1141221525 16:82073587-82073609 ACAGCAAGTTTTGTTTCAGATGG - Intronic
1143727244 17:8857591-8857613 CCAGGAATTTTTGTGGCAAATGG + Intronic
1144124813 17:12193269-12193291 CAAGGAAGCCATGTTGCAAAAGG - Intergenic
1144182367 17:12764224-12764246 CAGGGCAGTTTTGTGGTAGAGGG - Exonic
1144502239 17:15798740-15798762 GAAGGAAGTTCTGCTGCAGCTGG + Intergenic
1144793273 17:17873787-17873809 TGAGGAAGTTTTTCTGCAGAAGG + Intronic
1145164419 17:20601400-20601422 GAAGGAAGTTCTGCTGCAGCTGG + Intergenic
1146913589 17:36663973-36663995 CAAGGAAGTCTTCTTGGAGAAGG + Intergenic
1147693443 17:42333200-42333222 GAGGGAAATTTTGCTGCAGAAGG + Intronic
1151445881 17:74163666-74163688 TAAGGAAGTTTTGCTGGAGGAGG - Intergenic
1151912547 17:77093507-77093529 AAAGGAACTTTGGCTGCAGAGGG + Intronic
1154117171 18:11621278-11621300 CAAAGAGGCTTTCTTGCAGAAGG + Intergenic
1154395890 18:13988348-13988370 GAAAGAAGTTTTGATGGAGAAGG + Intergenic
1154998515 18:21664457-21664479 CAAGGAAGGCTTGATGCAGATGG + Intronic
1155636164 18:27957877-27957899 AAAGCAATTTTTGATGCAGAAGG + Intronic
1156500779 18:37556390-37556412 ATTGGAAGTTTTGGTGCAGAAGG - Intronic
1157193009 18:45597028-45597050 CAAAGAAGGTTGGTTGCAGCCGG + Intronic
1157993417 18:52525353-52525375 TAGGGAAGTTGTGGTGCAGAGGG - Intronic
1158815403 18:61089133-61089155 TAAGGAAGTCTTGGTGCAGAGGG + Intergenic
1159066054 18:63568722-63568744 CCACGCAGTTTTTTTGCAGAAGG + Intergenic
1159182009 18:64919860-64919882 AAAGGAAGTAATGATGCAGAAGG + Intergenic
1159318616 18:66815066-66815088 CAGGGAAGTTTGATTACAGATGG + Intergenic
1160323780 18:77921099-77921121 CAAGGAACTTTTGCTGATGAAGG + Intergenic
1160464514 18:79065106-79065128 CTAGGAAGTTTAGTAGGAGAGGG - Intergenic
1163482125 19:17563024-17563046 CAAGGCAGCTTTGTGTCAGAAGG - Intronic
1164525929 19:29013602-29013624 CAAGGAAGTCTTCCTGCAGGAGG + Intergenic
1165277493 19:34767583-34767605 CTAGGTAGTTTTGATGCACAGGG - Intronic
1165667750 19:37648281-37648303 GAAGGAAGTTTTGGTTTAGATGG - Intronic
925775450 2:7330838-7330860 TAAGGCAGTTTTGTTTCATATGG - Intergenic
926430089 2:12776809-12776831 CAAGGATGTGTTGCTGCAGGTGG - Intergenic
928489355 2:31765324-31765346 GAAGGAAGTTGAGTTACAGATGG - Intergenic
929249948 2:39742240-39742262 CAAGGAAGCTTGGTCACAGAAGG + Intronic
929633162 2:43487452-43487474 CAAAGGAGTTTTGTTTCAGAGGG - Intronic
930875311 2:56208866-56208888 CAAGGAAATTTTGTTTTATATGG - Intronic
932586294 2:73031703-73031725 CTAGGAATTTTTGTTGAAAATGG - Intronic
933351818 2:81162513-81162535 CAGTGAAGTTTTGTTGGAAATGG - Intergenic
934096984 2:88615764-88615786 TCAAGGAGTTTTGTTGCAGAGGG - Intronic
936784047 2:116071841-116071863 CAAGGAAATATTGTTGGAAAAGG - Intergenic
937861361 2:126714026-126714048 CAATGAGGTATTGGTGCAGAAGG + Intergenic
937924868 2:127160328-127160350 CAAGGAAGTTTTCTTTTAGTGGG - Intergenic
939386797 2:141510850-141510872 CAAGGAAGGTATGTTGCAAGGGG - Intronic
939966573 2:148616152-148616174 GAAGGAAGTTTTGGTGGAGATGG - Intergenic
941357977 2:164515567-164515589 AAAGGAAGATTTGTGGCTGAAGG - Intronic
1169074081 20:2750848-2750870 GAAGGAAGGGTGGTTGCAGAAGG + Intronic
1172975356 20:38902203-38902225 CAATCAATTTTAGTTGCAGAAGG - Intronic
1173754606 20:45504528-45504550 GAAGGCAGTTCTGTTGCAGTGGG - Intergenic
1182838184 22:33361564-33361586 CAAGGATGTTTTGGGGCTGAGGG + Intronic
1182952406 22:34390183-34390205 CTTGGAAGTTTTGTCCCAGAGGG + Intergenic
949897388 3:8778380-8778402 CAAGGAATTGTTGTTGGAGCTGG - Intronic
949912388 3:8922703-8922725 TCTGGAAGTTTTGTTTCAGAGGG - Intronic
952057744 3:29469709-29469731 AAGGGATATTTTGTTGCAGAGGG + Intronic
952861514 3:37816647-37816669 CAAGCACCTTTTCTTGCAGAGGG + Intronic
952993589 3:38855302-38855324 CAATGAGGTTATGTTCCAGAGGG - Intronic
954570535 3:51637300-51637322 CAATGAGGTTGTTTTGCAGAGGG - Exonic
955445635 3:59007121-59007143 CAATGGGGTTTTGTTCCAGAGGG - Intronic
955511140 3:59681504-59681526 CAAGGAGGTCTTTTTGGAGAGGG - Intergenic
958510213 3:95037894-95037916 CAAGGGAGTTATGTTCCAGAGGG + Intergenic
958966161 3:100561162-100561184 CTAGACAGTTTTGTTTCAGAGGG - Intronic
959667523 3:108938160-108938182 CAGTGAATTTTTGTTGGAGATGG - Intronic
961550858 3:127669918-127669940 AAAGGCAGTTTTGGTGGAGATGG - Intronic
962224585 3:133595216-133595238 CATGGAAGTATTGTTGGAGAAGG - Intergenic
963243968 3:143042822-143042844 CAAGGAAAGTTTGTTGCAAATGG + Intronic
963381265 3:144533432-144533454 CAAGCAAGTTCTTTTGCAGAGGG - Intergenic
963932558 3:151018961-151018983 CCATGAAGTTTTGTTGAATAAGG - Intergenic
966968776 3:185022420-185022442 CTAGGAATTTTCATTGCAGAAGG + Intronic
967874979 3:194262149-194262171 CAAGGAAGCTTTTTATCAGAAGG + Intergenic
969561860 4:7953595-7953617 TAAGGAAATTGTTTTGCAGAAGG - Intergenic
972131206 4:35836106-35836128 CCAGGAAATGTTGTTGCAGTTGG - Intergenic
972532090 4:39970632-39970654 CAGGGCAGTTTAGTGGCAGAGGG - Intronic
972989515 4:44806360-44806382 CAAGAAAGTCTTTCTGCAGAAGG - Intergenic
974156710 4:58082797-58082819 CAAAGCAGTTTTGTTTTAGAAGG + Intergenic
974555578 4:63443318-63443340 CAACGAACTTTTACTGCAGAAGG - Intergenic
974812479 4:66962601-66962623 CAAGGGAGTTTTGCTCAAGATGG + Intergenic
976562991 4:86523023-86523045 TAAGGAACTTATGTTGCAAAAGG - Intronic
978093699 4:104749235-104749257 GGAGGAAGTTTTGCTGCAGATGG + Intergenic
979130697 4:117041034-117041056 AAAGCAAGTTCTGTTTCAGATGG - Intergenic
979153654 4:117354416-117354438 CATGGAAGTTTTGTTTAACATGG - Intergenic
980502989 4:133681657-133681679 CAATGATGTTTTGCTGGAGATGG + Intergenic
981761948 4:148204263-148204285 CAAGGAACTTTTTTTTCAGGAGG + Intronic
982450648 4:155548588-155548610 GAAGGATGTTTTTTTTCAGAAGG + Intergenic
982696220 4:158604095-158604117 CAAGAAAGTTTTTTTTAAGAAGG + Intronic
983369988 4:166845376-166845398 CAAGGAAGTGTAGTTGTATAGGG - Intronic
983694815 4:170514937-170514959 CTAGGAGGTTGTGTTACAGACGG + Intergenic
987395117 5:17415792-17415814 CAAGGCAGTTTTATTCCTGAAGG - Intergenic
988433044 5:31141927-31141949 CAAGAAAGTTTCATTGCATATGG - Intergenic
989128062 5:38075961-38075983 TAAGTAAGTCTTGGTGCAGAAGG - Intergenic
989183807 5:38603709-38603731 CTAGGAAGTTTTCTTTCTGAGGG - Intronic
989949371 5:50279617-50279639 CAAGGGATTTCTGTTGAAGATGG + Intergenic
990005366 5:50938900-50938922 CAATGAGGTTATGTTACAGAGGG - Intergenic
990546497 5:56827057-56827079 CAAGGAGGTTTTGTGGCCTAGGG + Intronic
992339427 5:75807462-75807484 GAAGGATGTTTAGTTGCAGCAGG - Intergenic
992998491 5:82356150-82356172 CAAAGAAATTTTTTTGCAAATGG - Intronic
994208242 5:97059821-97059843 CAATGGTGTTGTGTTGCAGAGGG + Intergenic
994564459 5:101423922-101423944 TAATGAAATTTTGTTTCAGAGGG + Intergenic
999523488 5:152377183-152377205 CAAGAATGCCTTGTTGCAGATGG + Intergenic
1000118638 5:158176162-158176184 CAAGGAAGCTTTGAGGCAGGAGG + Intergenic
1000571018 5:162913943-162913965 CAGGGAAGTTTCATTGCATACGG + Intergenic
1001565598 5:172697368-172697390 AAAGGCTGGTTTGTTGCAGAAGG - Intergenic
1002317636 5:178354065-178354087 CAAGGCAGTGTGGTTGCTGAAGG + Intronic
1003496628 6:6668917-6668939 CCTGGAAGCTTTGTTCCAGATGG - Intergenic
1003661779 6:8069020-8069042 CAAGGTATGTGTGTTGCAGAAGG + Intronic
1004180069 6:13373249-13373271 GAAGAAAGTTTTGCTGGAGAGGG + Intronic
1008296705 6:49786896-49786918 CAAGGATGTTCTGTTCCTGAAGG - Exonic
1008864070 6:56188750-56188772 CAGGGAAGCTTTGTCCCAGAGGG - Intronic
1010094952 6:72032010-72032032 CAAGGAAGTCTTCTTGTAGAGGG + Intronic
1012340203 6:98111811-98111833 CAAGGAAGTTTTGATATAAAAGG + Intergenic
1014150719 6:118051766-118051788 GAAGTAAGTTTTCTTGCAGGAGG + Intronic
1014407184 6:121066233-121066255 CAAGGAAGCTTTGTTTCTGTAGG - Intergenic
1016425645 6:143933551-143933573 CAATGGAGTTATGTTCCAGAGGG + Intronic
1019108803 6:169692712-169692734 CAATGGAGTTATGTTCCAGAGGG - Intronic
1021868072 7:24978918-24978940 CAAGCAAGTTGCGTTGCCGAAGG + Intronic
1022239718 7:28498898-28498920 AAGGGAAGTTGTGATGCAGAAGG + Intronic
1024242790 7:47448284-47448306 CAAGGAAGTTTTGTTGCAGAGGG - Intronic
1027545549 7:79523604-79523626 CTAGGTAGTGTGGTTGCAGAAGG - Intergenic
1027821073 7:83045428-83045450 TAAGGAAGTCTTGGAGCAGAAGG - Intronic
1029081052 7:97974034-97974056 CATGGCAGTTTTTTTGTAGAAGG + Intergenic
1030421354 7:109310251-109310273 CAATGAAGTGTTGTTGCTAATGG + Intergenic
1030673759 7:112364379-112364401 GAAGGAGGTTCTGCTGCAGATGG + Intergenic
1030712667 7:112769446-112769468 CAATGATGTTTTGTGGCAGATGG - Intronic
1031765498 7:125772302-125772324 CAAGGATATTTTCCTGCAGATGG - Intergenic
1031808395 7:126335670-126335692 GAAGAAAGATGTGTTGCAGATGG - Intergenic
1031937969 7:127755334-127755356 CGAGGAAGTTCTGTTCAAGAAGG + Intronic
1032355274 7:131205141-131205163 CATGGAATTGTTGCTGCAGAGGG - Intronic
1032714675 7:134497224-134497246 CAAGGAACTTTTGTTTAATATGG - Intergenic
1032756184 7:134892894-134892916 CAAGGAAGTTTTGATGAAGAGGG - Intronic
1032867935 7:135947300-135947322 CAAGAGAGTATTGTTGCAAAAGG - Intronic
1032877184 7:136050093-136050115 AAAGAAAGCTTTGTTGCAAATGG + Intergenic
1033121324 7:138669137-138669159 CAAGAAAGCTTTGTTCCAAAAGG + Intronic
1033985116 7:147215586-147215608 CAATGAAGATTTCTTGCAGTAGG - Intronic
1034737239 7:153440527-153440549 CATGGAAGTCTGCTTGCAGAAGG + Intergenic
1035059094 7:156056001-156056023 CAAGGAAGTTTTCAGGCAGGAGG - Intergenic
1035136525 7:156708947-156708969 CAATGGGGTTTTGTTCCAGAGGG - Intronic
1035722772 8:1804498-1804520 CAAGGCAGTGTTGATGAAGATGG - Intergenic
1036186995 8:6631102-6631124 CAGGAAAGTTTTGTGGCACATGG + Intronic
1037406781 8:18551064-18551086 CTAGAAAATTTTGTTTCAGAGGG + Intronic
1037707864 8:21330920-21330942 GAAGGATGTTTTGATGCAGCAGG - Intergenic
1037856229 8:22372682-22372704 CTAGAAAGATTTGTTGCAAATGG - Intronic
1039124425 8:34185187-34185209 CAGGAAAGCTTTGCTGCAGAGGG - Intergenic
1039408178 8:37330343-37330365 CAAGGATTTTTGGTTGCAGAGGG + Intergenic
1039898476 8:41733310-41733332 CAAGGAAGACTTGCTGGAGAAGG + Intronic
1040868022 8:52070366-52070388 CAATGAGGTTATGTTCCAGAGGG + Intergenic
1041562538 8:59236288-59236310 CCAAGGAGTTCTGTTGCAGAAGG + Intergenic
1043246346 8:78007036-78007058 CAAAGAAATTGTGTTTCAGATGG - Intergenic
1043337665 8:79196916-79196938 CAAGTAAAGTTTGTTGCTGAGGG + Intergenic
1044669182 8:94661336-94661358 CAAAAATGCTTTGTTGCAGATGG - Intronic
1045626359 8:104056412-104056434 AAAAGGAGTTTTGTAGCAGATGG + Intronic
1045799507 8:106086237-106086259 CAGGGAAATGTTGATGCAGATGG - Intergenic
1047310146 8:123685089-123685111 TGATGAAGTTTTGTTCCAGAAGG - Intronic
1048177461 8:132165496-132165518 CAAGGGAGTATTGATGCCGAAGG - Intronic
1049292102 8:141809459-141809481 CTAAGAAGTTTTTATGCAGATGG - Intergenic
1050668869 9:7973445-7973467 AAAAGAATTTTTGTTTCAGAAGG - Intergenic
1051341424 9:16115439-16115461 CAAGGAAGGATTGGTGCAAAGGG + Intergenic
1058427088 9:104884523-104884545 CAAGGAAGTGTTCCTGCAGAGGG + Exonic
1058462446 9:105195765-105195787 CAAGAATGTTTTCTTGCACATGG - Intergenic
1058947511 9:109872422-109872444 CAAGGAATTCATGTTGCAGTAGG - Intronic
1059259336 9:112960640-112960662 CAATTAACTTTTGTTGCAGGAGG + Intergenic
1061042800 9:128149633-128149655 CCTGGAAGTTCTGCTGCAGAGGG - Exonic
1185831997 X:3311141-3311163 CAAGTAAGTCTTGTTCCGGATGG + Exonic
1186520972 X:10206582-10206604 GAAGAAAGTTTCGCTGCAGATGG - Intronic
1186885721 X:13911403-13911425 CAAGGAAATTTTGGTGATGATGG + Intronic
1188636770 X:32443187-32443209 AAAGGAAGATTTATTTCAGAAGG + Intronic
1194103613 X:89738723-89738745 CAATGGAGTTATGTTCCAGAGGG + Intergenic
1194620856 X:96169578-96169600 TAAGGAAGTCTGGTTGCAGTGGG + Intergenic
1196703762 X:118698917-118698939 CAAGGATGTCTTCTTTCAGATGG + Intergenic
1198653841 X:138892514-138892536 CAATGAAGGTTTTTTGCAGGAGG + Intronic
1199763616 X:150924823-150924845 AAAGGAGGTATTGTTGAAGATGG + Intergenic
1200254927 X:154575542-154575564 CAAGGAAGTTTTGTGGAGTAAGG + Intergenic
1200262842 X:154628866-154628888 CAAGGAAGTTTTGTGGAGTAAGG - Intergenic
1200571770 Y:4840964-4840986 CAAGGGAGTCTTGTTTCATAAGG - Intergenic
1201244008 Y:11985939-11985961 CAAGTAAGTCTTGTTCCAGATGG - Intergenic
1201586670 Y:15568761-15568783 GAAGGAAGTCATGTTGCAGTAGG + Intergenic
1201942241 Y:19472886-19472908 TCTGGAAGTTTTGTTTCAGAGGG + Intergenic