ID: 1024242791

View in Genome Browser
Species Human (GRCh38)
Location 7:47448285-47448307
Sequence TCAAGGAAGTTTTGTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 213}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242791_1024242805 26 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242805 7:47448334-47448356 GGATCCTCCCCAGGTGGGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 193
1024242791_1024242804 25 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242804 7:47448333-47448355 GGGATCCTCCCCAGGTGGGGTGG 0: 1
1: 0
2: 2
3: 15
4: 238
1024242791_1024242803 22 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242803 7:47448330-47448352 CATGGGATCCTCCCCAGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 191
1024242791_1024242801 20 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242801 7:47448328-47448350 GACATGGGATCCTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 6
4: 129
1024242791_1024242802 21 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242802 7:47448329-47448351 ACATGGGATCCTCCCCAGGTGGG 0: 1
1: 0
2: 6
3: 12
4: 129
1024242791_1024242800 17 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242800 7:47448325-47448347 GGAGACATGGGATCCTCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 145
1024242791_1024242794 -4 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242794 7:47448304-47448326 TTGAAGTCCACGACGTCCCAGGG No data
1024242791_1024242793 -5 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242791_1024242797 5 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242797 7:47448313-47448335 ACGACGTCCCAGGGAGACATGGG No data
1024242791_1024242796 4 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242796 7:47448312-47448334 CACGACGTCCCAGGGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242791 Original CRISPR TCAAGGAAGTTTTGTTGCAG AGG (reversed) Intronic
903845009 1:26274402-26274424 TCAAGAAAGTTATGTTTGAGTGG + Intronic
904280063 1:29412889-29412911 TGAAGGAGGTTTTGATGAAGAGG - Intergenic
908181162 1:61607287-61607309 TCAAGGAAGTGTTCTTGGAGCGG + Intergenic
908623697 1:66015493-66015515 TCAGGGAAACTTCGTTGCAGAGG + Intronic
909717412 1:78725845-78725867 TTATGTAATTTTTGTTGCAGAGG - Intergenic
909966014 1:81911568-81911590 TCAAGGTAGTTTTGCTGCTTCGG + Intronic
913717079 1:121547056-121547078 TCAATAAATTTTTGTTGAAGTGG - Intergenic
914950149 1:152106810-152106832 TACAGGAAGTTTTTATGCAGAGG + Exonic
915541113 1:156566767-156566789 TCAAGGAAGATTTGCTGGGGTGG - Intronic
916241081 1:162640432-162640454 TGAGGGAGGTTTTGTAGCAGAGG + Intronic
917215411 1:172673081-172673103 TCCAGGAAGTTTTCAAGCAGAGG - Intergenic
918844389 1:189590735-189590757 TCATCTAAGTTTTGTTGCTGTGG - Intergenic
920716258 1:208343058-208343080 TCAAGAAACTTTGGTTCCAGTGG + Intergenic
921130930 1:212219056-212219078 TCCAGGAGGTTATGTTTCAGAGG + Intergenic
923629718 1:235641982-235642004 TCATGGAAGTTCTGTTACGGTGG - Intronic
1062923636 10:1298326-1298348 CCAAGGAAGGTTTTTTGGAGTGG + Intronic
1063855560 10:10248274-10248296 TCGTGGGAGTTTTTTTGCAGGGG - Intergenic
1064963867 10:20995668-20995690 TCAAGGATGTTTTGATGTGGAGG - Intronic
1068513282 10:57993470-57993492 TCACGGAAGCTTTGTTGCAATGG + Intergenic
1070515616 10:77203240-77203262 TTAAAGAAGTTTTGTAACAGTGG + Intronic
1072676606 10:97470992-97471014 TCAAGCAAGTCTTCTTGCTGGGG - Intronic
1073463635 10:103681106-103681128 TCCAGAAGGTTTTGTTGCTGGGG - Intronic
1078965294 11:16332886-16332908 GCAAGGAAACTTTTTTGCAGAGG + Intronic
1079655692 11:22984135-22984157 TCAAGGTAGATTTATTACAGAGG - Intergenic
1079968923 11:27012331-27012353 ACAAAGTAGTTTTGTTGCCGGGG + Intergenic
1081077384 11:38693660-38693682 CCATGGCAGTTTTGGTGCAGAGG - Intergenic
1081752466 11:45521579-45521601 GCAAGGAAGGTTTGGTGCTGGGG + Intergenic
1083006469 11:59351385-59351407 TCATGGAAGTCTTGGTGCAAGGG + Intergenic
1086048257 11:82558726-82558748 TCAAGGAGTTTTTGTTTCAGTGG + Intergenic
1087110239 11:94458256-94458278 TCAAGGTAGTTATATTACAGGGG - Intronic
1088947543 11:114529914-114529936 TCAAGGAATCTTTTTTTCAGTGG + Intronic
1095832597 12:46603781-46603803 TCAAGGATGTGTAGATGCAGGGG - Intergenic
1096775127 12:53959088-53959110 TGAAGGAAGAGTGGTTGCAGGGG + Intergenic
1097400355 12:59120981-59121003 TCAAGGAAGTTTTATAGAAGAGG + Intergenic
1098580902 12:72097736-72097758 TCAATGAAGATTAGGTGCAGTGG - Intronic
1099127927 12:78789341-78789363 TCATGGAAGTTATGTTGCAGTGG - Intergenic
1100828527 12:98496919-98496941 TCAAGGAGCTTTTATTTCAGTGG - Intronic
1101030265 12:100651398-100651420 CCAAGGAAGTTTTTGAGCAGTGG - Intergenic
1101198427 12:102409337-102409359 TCAAGGAACTTATGTTTTAGTGG - Intronic
1102716698 12:114979920-114979942 TCAAGGAACTTATGGTCCAGTGG + Intergenic
1103030549 12:117608810-117608832 CCATGGATGTTTTGCTGCAGAGG - Intronic
1103571737 12:121849491-121849513 CCGGGGAAGTTTGGTTGCAGAGG + Intronic
1104539762 12:129653062-129653084 TCAAGGAAGCTCTGTTGGATGGG + Intronic
1105568498 13:21576357-21576379 TCCAGGAAGTCTTTTTGCATGGG - Intronic
1106369797 13:29121050-29121072 TCAAGGGAGTGTTATTTCAGTGG + Intronic
1107537022 13:41345543-41345565 TTAAGGAAGTTTTGTTTTTGTGG + Intronic
1109452051 13:62529231-62529253 TGAAGGACTTTTTGTTGCTGGGG - Intergenic
1110785785 13:79523949-79523971 TCATTGAAGTATTGCTGCAGAGG + Intronic
1112433479 13:99373635-99373657 TCAGGGCAGTGGTGTTGCAGAGG + Intronic
1112724240 13:102283674-102283696 TCAATGAAGTATGGTTACAGTGG - Intronic
1113346333 13:109482211-109482233 TTAATGAAATTTTGTTCCAGTGG - Intergenic
1115417384 14:33152166-33152188 CCAGGTAATTTTTGTTGCAGGGG - Intronic
1118511967 14:66484942-66484964 CCAAAGAAGTTTTGATGTAGAGG + Intergenic
1119148967 14:72340882-72340904 TCCAGAAAGTTATGTTCCAGAGG + Intronic
1124841504 15:33246125-33246147 TCATGAAAGCTTTGTTTCAGTGG - Intergenic
1125348404 15:38742588-38742610 TCAAGAAAATTATGCTGCAGAGG - Intergenic
1127517437 15:59710016-59710038 TCAAGGATGCTTTGGTCCAGGGG - Intergenic
1128124250 15:65180255-65180277 TCAAGGAATTTTTGTTTCCAGGG - Intronic
1129514311 15:76147741-76147763 TCAATTAAGTCTGGTTGCAGTGG + Intronic
1129780700 15:78268803-78268825 TCATGGAGCTTATGTTGCAGTGG + Intronic
1130569071 15:85024250-85024272 TCAAGGAAGTTATGGTCTAGGGG - Intronic
1133090767 16:3402104-3402126 TCTGGGCAGTTTTTTTGCAGAGG - Exonic
1134343600 16:13368291-13368313 TCAAGGAATTTTGGTAGCACAGG + Intergenic
1137881718 16:52055911-52055933 TCAAGGAAGTTTTGTTGTGGAGG - Intronic
1138977121 16:62221139-62221161 TCAAGAAACTTTTAATGCAGTGG - Intergenic
1139940224 16:70600229-70600251 TCAAGCAGGCTTTGTGGCAGGGG - Intronic
1142706389 17:1697647-1697669 TCAAGGAAATGCTGCTGCAGTGG + Intergenic
1144231200 17:13205836-13205858 TAAAGGAAGTTTTGTTGGGAAGG + Intergenic
1144279979 17:13716492-13716514 TCAAGGAAGTTTCCTTGCACAGG + Intergenic
1144749334 17:17637645-17637667 CCAAGCAGGATTTGTTGCAGGGG + Intergenic
1145781174 17:27564483-27564505 CCAAGGAAGTCTGGATGCAGGGG + Intronic
1146514830 17:33480883-33480905 GAAAGGAAGTATGGTTGCAGTGG - Intronic
1148327331 17:46790725-46790747 TCAGGGAAGTTTTGCTTCTGTGG - Intronic
1150511422 17:65756586-65756608 TAAAAGAAATTTTGTTGTAGTGG + Intronic
1151826609 17:76527500-76527522 TCAAGGATGTTTTGCTGCTGTGG - Exonic
1151912546 17:77093506-77093528 TAAAGGAACTTTGGCTGCAGAGG + Intronic
1155173185 18:23282275-23282297 CCAAGGAAGTTGGGTGGCAGGGG + Intronic
1155640006 18:28001905-28001927 TCAATGATATTTTATTGCAGTGG + Intronic
1155690589 18:28617573-28617595 TGAAGGTAGTTTTGTTGCCTAGG - Intergenic
1157138998 18:45086625-45086647 GCAAGGCAGTTGTGGTGCAGGGG - Intergenic
1157488078 18:48103467-48103489 TAAAGAAATTTTTGTTGCTGGGG - Intronic
1157910939 18:51616949-51616971 TCATGGAACTTTTATTCCAGTGG + Intergenic
1158671201 18:59475606-59475628 TCAAGGAAGGCTTCTTGAAGGGG - Intronic
1158815402 18:61089132-61089154 CTAAGGAAGTCTTGGTGCAGAGG + Intergenic
1160121559 18:76134935-76134957 TCAAGGAAGTCATGTTGGGGAGG + Intergenic
1160464515 18:79065107-79065129 TCTAGGAAGTTTAGTAGGAGAGG - Intergenic
1161873794 19:6891802-6891824 TCAAGGAAGTGATGTTCCAGTGG + Intronic
1162456687 19:10789256-10789278 TGAAGGAAGTGTTGTTGTGGAGG + Intronic
1164906213 19:31970367-31970389 CCAGGGAAGTTTTGCAGCAGTGG - Intergenic
926914115 2:17877360-17877382 TAAAGGGAGTTTTGGTCCAGAGG - Intergenic
929633163 2:43487453-43487475 TCAAAGGAGTTTTGTTTCAGAGG - Intronic
930917326 2:56709186-56709208 CAATGGAAGTTTTGTAGCAGAGG + Intergenic
931816909 2:65913441-65913463 TAAGAGAAGTTTTGTTTCAGTGG + Intergenic
932120092 2:69090737-69090759 TCAAGGACATTTGGTTGCGGTGG - Intronic
934096985 2:88615765-88615787 TTCAAGGAGTTTTGTTGCAGAGG - Intronic
934605411 2:95691461-95691483 TCGGACAAGTTTTGTTGCAGGGG + Intergenic
935856447 2:107279701-107279723 TCAAGGAAGTTACTTGGCAGAGG - Intergenic
936538871 2:113334006-113334028 TCAGACAAGTTTTGTTGCAGGGG + Intergenic
937378242 2:121352591-121352613 CCAAGGAAGTTTTTTGCCAGAGG - Intronic
937743014 2:125377976-125377998 TCATGGAATTTATGTTGCAAAGG - Intergenic
937924869 2:127160329-127160351 CCAAGGAAGTTTTCTTTTAGTGG - Intergenic
938052757 2:128190309-128190331 TCAAGGCTGGTTTGGTGCAGTGG + Exonic
939386798 2:141510851-141510873 ACAAGGAAGGTATGTTGCAAGGG - Intronic
939871819 2:147534449-147534471 TCAGGAAATTCTTGTTGCAGTGG + Intergenic
940391518 2:153137916-153137938 TCAAGGAGGTTTGGTTGAAGAGG - Intergenic
943018970 2:182550222-182550244 TCAAGGAATTTTTGGTGGACTGG - Intergenic
946158477 2:217822010-217822032 TCCAGGAAGCTGTGTTCCAGGGG - Intronic
947008751 2:225541568-225541590 TCTTGGAACTTTTGTTGAAGAGG + Intronic
947887399 2:233584603-233584625 TCACGGAATTCTTGTTGCATTGG - Intergenic
948248448 2:236505916-236505938 TTAAAGGAGTTTTGCTGCAGAGG - Intronic
1169831461 20:9830083-9830105 TCAAGGGGTCTTTGTTGCAGAGG + Intronic
1169952985 20:11067788-11067810 TCAAAGAAGTTTTCTTGGAAAGG + Intergenic
1171344238 20:24453352-24453374 TCAAGGAACTTATGTTCCACTGG - Intergenic
1173754607 20:45504529-45504551 AGAAGGCAGTTCTGTTGCAGTGG - Intergenic
1174381882 20:50161155-50161177 TCAGGTAAGGTTTGTTCCAGTGG - Intergenic
1174447293 20:50598646-50598668 TCAAGGTAGTTATGTTCTAGAGG + Intronic
1175373922 20:58512070-58512092 TGAAGGAAGGTTCGCTGCAGTGG + Intronic
1175529557 20:59665127-59665149 TTAAGGAAGTTTTTCTACAGTGG - Intronic
1175599382 20:60260491-60260513 TCAAGGAAGTCTTCCTGCAGAGG + Intergenic
1177370495 21:20197374-20197396 ACAAGGAAGTTTTGTGGTAGGGG + Intergenic
1178497475 21:33099495-33099517 TCTAGCAAGTTGTTTTGCAGGGG - Intergenic
1178609690 21:34070135-34070157 TCAAGTAAGTTTTTTTGAGGGGG - Intergenic
1182582461 22:31322761-31322783 ACAAAGAAGTTTTATTTCAGAGG + Intergenic
1182952405 22:34390182-34390204 TCTTGGAAGTTTTGTCCCAGAGG + Intergenic
1183138733 22:35915920-35915942 TCCAGGAAGTTAAGTGGCAGAGG + Intronic
949304336 3:2622578-2622600 ACAAGCAAGTTTTGAAGCAGAGG + Intronic
949863377 3:8526724-8526746 ACAAGGGAGGTATGTTGCAGTGG - Intronic
951679406 3:25279292-25279314 TCAAGGCATTTATGATGCAGTGG - Intronic
952236712 3:31487497-31487519 TCAAGCAAGTTTTCTTGAAGGGG - Intergenic
954570536 3:51637301-51637323 TCAATGAGGTTGTTTTGCAGAGG - Exonic
956571096 3:70696134-70696156 TTAAACAAGTTTGGTTGCAGTGG - Intergenic
956593437 3:70941635-70941657 ACAAGCAAGTGTTGTGGCAGGGG - Intergenic
957031732 3:75250111-75250133 TCAAGGCACTTTTTTTTCAGGGG + Intergenic
957340090 3:78884443-78884465 TTAAAGAATTTTTTTTGCAGAGG - Intronic
958510212 3:95037893-95037915 CCAAGGGAGTTATGTTCCAGAGG + Intergenic
958762642 3:98327373-98327395 TCAAGGAAGTTGTATTACAGAGG - Intergenic
958857561 3:99404329-99404351 TCAAGGAAGATTTGTTAAACAGG - Intergenic
958889816 3:99770943-99770965 TCAAGGAAGTCTTGTCTGAGGGG + Intronic
958966162 3:100561163-100561185 TCTAGACAGTTTTGTTTCAGAGG - Intronic
959242445 3:103814434-103814456 TCAACTAGGATTTGTTGCAGAGG - Intergenic
961130828 3:124466134-124466156 TTAAAGAAGTTTTGGTGCTGGGG - Intronic
963381266 3:144533433-144533455 GCAAGCAAGTTCTTTTGCAGAGG - Intergenic
966046265 3:175554048-175554070 TCAAGGAAGTCTTCTGGGAGGGG + Intronic
967469450 3:189844649-189844671 TCAAGTGAGTTTTTTTGTAGAGG + Intronic
968638877 4:1699546-1699568 CCAAGGTAGTCTTGTTTCAGTGG - Exonic
969079082 4:4604200-4604222 TAAGAGAAGTTTTCTTGCAGGGG + Intergenic
969807220 4:9618382-9618404 TTATGGAAGTTTTGTCTCAGAGG - Intergenic
970073395 4:12189545-12189567 TCAAGGAAGGATTGATACAGTGG + Intergenic
970513526 4:16804521-16804543 TCAATGAAGTTTTGTTCCCAAGG + Intronic
973201630 4:47509922-47509944 TCATAGAACTTTTGTTTCAGGGG + Intronic
974354894 4:60798671-60798693 CCAAGGAATTTCTCTTGCAGTGG + Intergenic
976794620 4:88918739-88918761 TCAACTAAGCTTTGTGGCAGTGG + Intronic
977666305 4:99650202-99650224 TAAAGGAAGCTCTGCTGCAGGGG - Exonic
978859263 4:113429905-113429927 CTCTGGAAGTTTTGTTGCAGAGG + Intergenic
981480623 4:145235421-145235443 TCAAGTAATTTTTGCTGCAGAGG - Intergenic
981667141 4:147242281-147242303 TCGAGGATTTTTTATTGCAGAGG - Intergenic
982456297 4:155612729-155612751 TCAAGGAAGTTTTGTTTTCCAGG + Intergenic
986179323 5:5378675-5378697 TCAAAGAAGTTTTATTGAAATGG - Intergenic
989961481 5:50420723-50420745 TCAATAAATTTTTGTTGAAGTGG + Intronic
991119419 5:62994123-62994145 TCAACAAAGGTTTGCTGCAGGGG - Intergenic
992141539 5:73801893-73801915 TCAAGGAAATTTTCTTACTGTGG + Intronic
993323706 5:86507493-86507515 TGAAGAAAGTTTCATTGCAGTGG - Intergenic
997277196 5:132604664-132604686 TCATTGTATTTTTGTTGCAGTGG + Intronic
998070562 5:139194784-139194806 TAAGTGAAGTTTTGCTGCAGAGG - Intronic
998351276 5:141503299-141503321 TCAAGAAAGAATTGTTGGAGGGG + Intronic
998735463 5:145134460-145134482 TTATGGAAGTTTTGTTTCAGTGG + Intergenic
1000777644 5:165440169-165440191 TCCATGTTGTTTTGTTGCAGGGG + Intergenic
1003707183 6:8545915-8545937 TCAAGGAAGTCTCCTTGGAGAGG - Intergenic
1005948544 6:30613819-30613841 CCAAGGAAGATATGCTGCAGAGG + Intronic
1006035284 6:31206813-31206835 GAAAGGAAGTTTGGGTGCAGTGG + Intergenic
1006972736 6:38063433-38063455 TGAATGATTTTTTGTTGCAGAGG - Intronic
1009814688 6:68717060-68717082 TCAAGAATGTTTTGTTGAAATGG + Intronic
1010094951 6:72032009-72032031 TCAAGGAAGTCTTCTTGTAGAGG + Intronic
1012841661 6:104336034-104336056 TAATGGATGTATTGTTGCAGAGG + Intergenic
1012970953 6:105730021-105730043 TTGAGGACTTTTTGTTGCAGGGG - Intergenic
1013233683 6:108177811-108177833 CCAAGGAAAATTTGCTGCAGGGG + Intronic
1013235175 6:108192137-108192159 TCCAGGAAGCATTGTAGCAGAGG - Intergenic
1013274435 6:108570613-108570635 ACAAGGAAGGCTGGTTGCAGGGG - Intronic
1013339210 6:109196754-109196776 TGAAGGAAGTTTTGTATGAGAGG + Intergenic
1013989452 6:116236734-116236756 TCAAGGAAGTTATTTTGCCCAGG - Intronic
1014300590 6:119676892-119676914 ACAAGCAATTTTGGTTGCAGTGG + Intergenic
1014712461 6:124823265-124823287 TCAAAGAACTTTTTTCGCAGTGG + Exonic
1015654794 6:135505716-135505738 ACAAGGAAGTTTGTTTGTAGGGG - Intergenic
1016472670 6:144390861-144390883 TCAAGGAAGCTGTGGTCCAGTGG - Intronic
1018803871 6:167243668-167243690 TCATGGAAGTCTGGGTGCAGGGG - Intergenic
1019581874 7:1768483-1768505 TCAAGGAAGGCTGGTTGCAGAGG - Intergenic
1022591229 7:31665254-31665276 TCAATGAAGTCTTTTTGAAGAGG - Intergenic
1023342158 7:39232706-39232728 TCAAGCAAATATTATTGCAGTGG + Intronic
1024242791 7:47448285-47448307 TCAAGGAAGTTTTGTTGCAGAGG - Intronic
1027486154 7:78764281-78764303 TCAAAGAAGTTTTCTGTCAGAGG - Intronic
1027574991 7:79920702-79920724 TCAAGAGAGTTTTGTTCCAGGGG + Intergenic
1028430499 7:90741470-90741492 TCATGGAAGTTTATGTGCAGTGG + Intronic
1031316634 7:120266328-120266350 TCAAGGAAGTTACAGTGCAGTGG + Intergenic
1032163331 7:129527033-129527055 TCATGGAAGTGTTGAGGCAGGGG - Intergenic
1032756185 7:134892895-134892917 CCAAGGAAGTTTTGATGAAGAGG - Intronic
1033641508 7:143266526-143266548 TCTAGGAAGTCAAGTTGCAGTGG + Intronic
1034928665 7:155143479-155143501 TTACGGAAGTTTTGCTGTAGGGG + Intergenic
1037375589 8:18224299-18224321 TCAAGGAAGTCTTATTGCACAGG + Intergenic
1039124426 8:34185188-34185210 TCAGGAAAGCTTTGCTGCAGAGG - Intergenic
1039408177 8:37330342-37330364 CCAAGGATTTTTGGTTGCAGAGG + Intergenic
1041394701 8:57378583-57378605 TCACGGAAGTTTTGTGGGTGGGG - Intergenic
1042404474 8:68388005-68388027 TCATGGTAGTTGTGTTACAGTGG + Intronic
1042477370 8:69263789-69263811 TCACTGAACTTTTTTTGCAGTGG + Intergenic
1042604645 8:70533206-70533228 CCATGGAAGTGTTGATGCAGGGG + Intergenic
1042997105 8:74712892-74712914 TCAAAGAACTTGTGTTACAGCGG + Intronic
1043043031 8:75286208-75286230 TAAAAGAAGATTTGTTTCAGAGG - Intergenic
1043277241 8:78414184-78414206 ACAAGGAAATTTTGTTGTTGGGG + Intergenic
1043674453 8:82933610-82933632 AGAAGGGAGTGTTGTTGCAGAGG + Intergenic
1046213653 8:111114067-111114089 TAAAGGAATTTTGCTTGCAGAGG - Intergenic
1048120928 8:131581015-131581037 TCAAGGAAGCTGGTTTGCAGAGG + Intergenic
1048132483 8:131713155-131713177 TCAAGAAACTTTTTATGCAGTGG + Intergenic
1048518731 8:135134754-135134776 TCATGGCAGTTTTATTTCAGGGG + Intergenic
1048803572 8:138217827-138217849 TCACGGAGTTTTTGTAGCAGTGG + Intronic
1049237767 8:141520939-141520961 TCAGGGAAGGTTTGATCCAGGGG + Intergenic
1049719217 8:144107933-144107955 CCAGGGGAGTTTTGTTCCAGGGG - Intronic
1050001825 9:1085093-1085115 TCAATGAAGGTTTGTTCCATTGG + Intergenic
1050127861 9:2378161-2378183 TCAGGGAAGTCTTATTGAAGGGG + Intergenic
1051043183 9:12840347-12840369 TCTATGAAATTTTGTTACAGTGG + Intergenic
1051296343 9:15600489-15600511 TTCTGGAAGTTTTGTCGCAGAGG + Intronic
1051341423 9:16115438-16115460 TCAAGGAAGGATTGGTGCAAAGG + Intergenic
1054830453 9:69619169-69619191 TCAAGGAAGTTATCTAGGAGTGG + Intronic
1056706312 9:88955199-88955221 TAAGAAAAGTTTTGTTGCAGTGG + Intergenic
1056724705 9:89104578-89104600 TAAAGGAATTTGTGCTGCAGCGG + Intronic
1058427087 9:104884522-104884544 CCAAGGAAGTGTTCCTGCAGAGG + Exonic
1060769842 9:126325086-126325108 TCAAGCAAGATTTATTCCAGAGG - Intergenic
1061042802 9:128149634-128149656 TCCTGGAAGTTCTGCTGCAGAGG - Exonic
1194620855 X:96169577-96169599 GTAAGGAAGTCTGGTTGCAGTGG + Intergenic
1196012876 X:110906741-110906763 GCAAGGGAGTTTGGTTGTAGGGG + Intergenic
1196783758 X:119404585-119404607 TTATGGAAGATTTGTTACAGAGG + Intronic
1196802073 X:119552622-119552644 TTATGGAAGCTTTGTTACAGAGG + Intronic
1197491730 X:127125229-127125251 TCATAGAAGTGTTGTTCCAGAGG - Intergenic
1197616811 X:128701378-128701400 TCAAGGAGTTTATATTGCAGTGG + Intergenic
1197830245 X:130634234-130634256 ACAAGGAAGTTTTGGTGAATGGG + Intronic
1199246313 X:145609155-145609177 TCTAGAAATTATTGTTGCAGGGG - Intergenic
1199534043 X:148881738-148881760 TCAAAGGAATTTTGTTGTAGAGG - Intronic
1201771517 Y:17621100-17621122 TCAATGAATATTTGATGCAGAGG - Intergenic
1201830038 Y:18284886-18284908 TCAATGAATATTTGATGCAGAGG + Intergenic