ID: 1024242793

View in Genome Browser
Species Human (GRCh38)
Location 7:47448303-47448325
Sequence CTTGAAGTCCACGACGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024242789_1024242793 1 Left 1024242789 7:47448279-47448301 CCATTCCCTCTGCAACAAAACTT 0: 1
1: 0
2: 7
3: 51
4: 328
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242787_1024242793 3 Left 1024242787 7:47448277-47448299 CCCCATTCCCTCTGCAACAAAAC 0: 1
1: 0
2: 3
3: 20
4: 283
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242791_1024242793 -5 Left 1024242791 7:47448285-47448307 CCTCTGCAACAAAACTTCCTTGA 0: 1
1: 0
2: 2
3: 21
4: 213
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242790_1024242793 -4 Left 1024242790 7:47448284-47448306 CCCTCTGCAACAAAACTTCCTTG 0: 1
1: 0
2: 1
3: 23
4: 235
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data
1024242788_1024242793 2 Left 1024242788 7:47448278-47448300 CCCATTCCCTCTGCAACAAAACT 0: 1
1: 0
2: 3
3: 18
4: 258
Right 1024242793 7:47448303-47448325 CTTGAAGTCCACGACGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024242793 Original CRISPR CTTGAAGTCCACGACGTCCC AGG Intronic
No off target data available for this crispr