ID: 1024244938

View in Genome Browser
Species Human (GRCh38)
Location 7:47462254-47462276
Sequence GCTGTGACAATGATCGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024244938 Original CRISPR GCTGTGACAATGATCGTTAC TGG (reversed) Intronic
905939219 1:41849641-41849663 GCTGTGACCATGACAGTGACTGG + Intronic
908096433 1:60743758-60743780 ACTGTGAGAATTATGGTTACAGG + Intergenic
915966460 1:160313125-160313147 GCAGAGACCATGATCGTTTCTGG - Exonic
919604904 1:199669678-199669700 GATGGGACAGTGATAGTTACAGG - Intergenic
920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG + Intergenic
1066554284 10:36594081-36594103 CCTGAGACAATGATCTTCACTGG - Intergenic
1076825925 10:132968112-132968134 GCTGTGACAATGTGGATTACTGG + Intergenic
1094662886 12:32488059-32488081 GCTGTGAAAATGTTGGTAACTGG + Intronic
1106459076 13:29952675-29952697 GCTTTGACAATGATGGATATAGG + Intergenic
1106459737 13:29958587-29958609 GCTGTGACAATGATGGAAGCTGG - Intergenic
1108548407 13:51519478-51519500 GATGTGACACTGATGGTTTCAGG + Intergenic
1113764602 13:112873509-112873531 GCAGTGAGAATGATCGTGATGGG - Intronic
1115747424 14:36451794-36451816 ACTGTGACAATGAATGATACAGG - Intergenic
1116635160 14:47385244-47385266 ACTATGACACTGATCGTTTCTGG + Intronic
1116901252 14:50364076-50364098 GCTGTGACAGTGTCCTTTACTGG - Intronic
1117244919 14:53875104-53875126 GCTCTGAGAATGATCCTAACAGG - Intergenic
1125811707 15:42547897-42547919 GGTGTTATAATGATTGTTACTGG - Intronic
1127366177 15:58292815-58292837 GCTGTGACTATGAGCGTCAACGG + Intronic
1128530838 15:68446465-68446487 CCTTTGCCAATGATCGGTACAGG - Intergenic
1138499788 16:57433274-57433296 GCTGTGACAATGATCACTAGAGG - Intronic
1141292176 16:82728637-82728659 GATGTGACATTGATGGTTTCTGG + Intronic
1151409161 17:73909749-73909771 ACTGTGACAATGATCTTCCCAGG - Intergenic
1164876650 19:31695427-31695449 TCTGTGACAGTGATGGTGACAGG - Intergenic
927324058 2:21782673-21782695 GCTGTGACCTTGAGCCTTACAGG - Intergenic
929163998 2:38862270-38862292 GCTGTAACGATGAGCGGTACTGG - Exonic
936078079 2:109414453-109414475 GCTCTGACCATGATGGTAACAGG - Intronic
939003024 2:136758062-136758084 GCAGAGACAATGAGCATTACAGG + Intergenic
1169349846 20:4859402-4859424 GCTGTGGCACTGATCGTTTATGG - Intronic
1170787574 20:19480816-19480838 CCTGGGACACTGATCCTTACTGG + Intronic
1172531249 20:35632710-35632732 GCTGTGACTGTGATGCTTACTGG - Intronic
1178537883 21:33425237-33425259 GCAGTGACACTGATCGTGAGAGG + Intronic
1183340350 22:37276988-37277010 GCTGTTGCAATGATTGTTCCAGG + Intergenic
953205489 3:40824056-40824078 GCTATCACAGTGATCGTTTCTGG + Intergenic
955285165 3:57633517-57633539 CCTGTGAAAATAATCTTTACCGG + Intronic
960810745 3:121624930-121624952 GCTGTGACTCTGATTGATACAGG + Intronic
961831656 3:129626234-129626256 GCTGTGACAAGCATCTGTACAGG - Intergenic
964110440 3:153081972-153081994 TGTGTGAGAATGATGGTTACAGG - Intergenic
965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG + Intergenic
971646399 4:29210946-29210968 GCTGTTACAATGATTCTAACAGG + Intergenic
973058200 4:45686957-45686979 GCTGTGACAGTGATCTTCCCAGG - Intergenic
980619766 4:135285506-135285528 GCTGTGAGAATGACTGTTCCTGG + Intergenic
984410660 4:179393634-179393656 GCTGTGACAATGACTCTGACAGG - Intergenic
986333494 5:6735392-6735414 GCAGTGACAGTGATAGTGACTGG + Intronic
986736098 5:10668398-10668420 ACAGTGACAATGATGGTTACTGG - Intergenic
989564185 5:42885106-42885128 CCTGCTACAATGATGGTTACAGG - Intronic
992823436 5:80522059-80522081 GCTCTGACAGGGAACGTTACAGG - Exonic
999323575 5:150629496-150629518 GGTGTGACAAAGCTCCTTACTGG + Intronic
1002272343 5:178080867-178080889 GCTGTGAGAACGACCGTTGCCGG + Intergenic
1008525564 6:52403797-52403819 GCTATGCCAAATATCGTTACCGG + Exonic
1015078570 6:129194550-129194572 GATGTGAAAATGATCGGTAGGGG - Intronic
1024244938 7:47462254-47462276 GCTGTGACAATGATCGTTACTGG - Intronic
1028651313 7:93153007-93153029 GCTGTGACATTGATTGATACAGG - Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1039702422 8:39975873-39975895 GCTTTGACATTCATCATTACTGG - Intronic
1042979906 8:74514790-74514812 GCAGTGACAATGAGGGTTGCTGG - Intergenic
1196938950 X:120756940-120756962 GCTGGGACACTGATTGATACAGG + Intergenic
1199047235 X:143189370-143189392 GCTGTGACTATGATGGTAGCAGG - Intergenic