ID: 1024246216

View in Genome Browser
Species Human (GRCh38)
Location 7:47472289-47472311
Sequence CCATCTGTAGGGGAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024246216_1024246230 25 Left 1024246216 7:47472289-47472311 CCCTGTACCTCCCCTACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1024246230 7:47472337-47472359 GAGGCCCCACTGCATGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 142
1024246216_1024246227 3 Left 1024246216 7:47472289-47472311 CCCTGTACCTCCCCTACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1024246227 7:47472315-47472337 TCTGGGATCCGTGAGAAGGAGGG No data
1024246216_1024246225 -1 Left 1024246216 7:47472289-47472311 CCCTGTACCTCCCCTACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1024246225 7:47472311-47472333 GTTCTCTGGGATCCGTGAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 90
1024246216_1024246226 2 Left 1024246216 7:47472289-47472311 CCCTGTACCTCCCCTACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1024246226 7:47472314-47472336 CTCTGGGATCCGTGAGAAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 203
1024246216_1024246228 6 Left 1024246216 7:47472289-47472311 CCCTGTACCTCCCCTACAGATGG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1024246228 7:47472318-47472340 GGGATCCGTGAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024246216 Original CRISPR CCATCTGTAGGGGAGGTACA GGG (reversed) Intronic
904324600 1:29720174-29720196 CCATCTGTAAGTCAGGGACAGGG - Intergenic
909990338 1:82215769-82215791 GCATCTGTTGGGGAGATAAAAGG + Intergenic
912485628 1:110025354-110025376 CCAGCTGTAAGGGATTTACATGG + Intergenic
918847367 1:189634735-189634757 CCATGTGTTTGGGAGGTACGTGG - Intergenic
1075475467 10:122730051-122730073 CCAGCTGCAGGAAAGGTACATGG + Intergenic
1075700461 10:124466134-124466156 CCATCAGTAGGGGAGTTTTAGGG + Intronic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1078733241 11:13995589-13995611 CCATGTGTAGGGGAGGGACCTGG - Intronic
1081590835 11:44421995-44422017 CCATCTGGAAGGCAGGTCCACGG - Intergenic
1081622287 11:44625686-44625708 CCAGTTGTGGGGGAGGCACAGGG + Intergenic
1083008490 11:59371643-59371665 CCATCTTGAGGGAAGGTCCAGGG + Intergenic
1083209850 11:61176450-61176472 TCATCTGTAGGGAAGGGGCAGGG - Intergenic
1084363768 11:68684905-68684927 CCATCTGGAAGGGAAGGACAGGG - Exonic
1085010475 11:73137461-73137483 CACTCTGTAGGGGAGCTATAGGG - Intronic
1090665850 11:128914456-128914478 CAAACTGTAGGGGAGATCCAGGG + Intronic
1092964782 12:13631098-13631120 CCATGTGTTGGGGAGGGACCTGG - Intronic
1096152588 12:49323828-49323850 CCATCTCTAGGGGAGGGAGCGGG - Exonic
1098210937 12:68164637-68164659 CCACCTGGAGAGGATGTACATGG - Intergenic
1099131347 12:78836247-78836269 CCATCTGAAAGGGAGGGAGAAGG - Intergenic
1102493751 12:113305174-113305196 CCATCTCTAGGGGTCGTTCAGGG + Intronic
1102536055 12:113582486-113582508 CCATCTGCAGAGGAGAAACACGG - Intergenic
1103260306 12:119582488-119582510 CCATCTGTATGGGAGGGACCTGG + Intergenic
1109679468 13:65730990-65731012 CCATGTGTTGGGGAGGGACCTGG + Intergenic
1110370136 13:74730386-74730408 CCATATGTTGGGGGGGAACATGG - Intergenic
1118093142 14:62505086-62505108 CCATCTCTATGCGAGATACAAGG + Intergenic
1118271067 14:64342633-64342655 ACATCTGTCAGGAAGGTACATGG - Intergenic
1121521930 14:94592038-94592060 CCATCTGCAGGGGAGACACCAGG - Exonic
1123832155 15:24151083-24151105 AAATCTGTAGAGAAGGTACAAGG - Intergenic
1127704835 15:61536432-61536454 ACAGCTGTAGAGGAGGGACAAGG - Intergenic
1132398677 15:101491417-101491439 CCATCTGTAGGAGGGACACACGG - Intronic
1132732826 16:1371275-1371297 CCATGTGCAGGGGAGGGAAAGGG + Intronic
1133229116 16:4358161-4358183 GCATCTGTTGGGGAGGGACAGGG + Intronic
1135393907 16:22116569-22116591 CCATCTGCAGAGGAGGCAGAGGG + Intronic
1137761265 16:50942368-50942390 CCATCTGAAGGGTAGGTTCCTGG + Intergenic
1139959001 16:70706995-70707017 CCAGCTGTGGGGCAGGAACAAGG - Intronic
1141558572 16:84852295-84852317 CCATCTGGATGGTAGTTACACGG - Intronic
1145983788 17:29030716-29030738 GCAGATGTAGGGGAGGTGCAAGG + Intronic
1145999503 17:29122817-29122839 CCCTCTGGAGGGGAGGGCCAGGG - Intronic
1147665209 17:42142625-42142647 CCACCTGAAGGGGACATACATGG + Intronic
1148193967 17:45700059-45700081 CCATCTCAAGGGGAAGTGCAGGG + Intergenic
1153957798 18:10112962-10112984 CCCTCTGTAGGTGAGGCACAGGG - Intergenic
1155063710 18:22250970-22250992 CCATTTGGAGGAGAGGCACAAGG - Intergenic
1155609158 18:27643908-27643930 CCATTTATTTGGGAGGTACAAGG - Intergenic
1157607177 18:48933241-48933263 CCATAGGTGGGGGAGGTGCAGGG - Intronic
1161591167 19:5129762-5129784 CCATCTGGAGGAGGGGGACAGGG - Intronic
1165468522 19:35989609-35989631 CCACCTGCAGGGGAGGTAAGGGG - Intergenic
1167234117 19:48303531-48303553 CCATCTGTGCTGGAGGAACAAGG - Intronic
1167787965 19:51651330-51651352 CCAGGTGTAGGGGAAGTGCAGGG + Intergenic
1168586213 19:57594824-57594846 CCTTCTGGAGGGCAGATACAGGG + Intergenic
928679085 2:33680678-33680700 CCATATGTCAGGGAGGGACATGG - Intergenic
929042746 2:37761278-37761300 CAACCTGTACAGGAGGTACAGGG + Intergenic
932358096 2:71083294-71083316 CCTTCTTTGGGGGAGGGACAGGG - Intergenic
932370435 2:71182861-71182883 CCTTCTTTGGGGGAGGGACAGGG - Exonic
935082264 2:99809611-99809633 CCAGCTGTAGGGGATGTTCTGGG + Intronic
935178901 2:100673272-100673294 CTGTCTGTAGGGGACGTAGATGG - Intergenic
937833020 2:126444433-126444455 CTATCTGTAGGGGAGAAAGATGG + Intergenic
940169831 2:150816364-150816386 CCTTCTCTTGGGGAGGGACAGGG - Intergenic
940722748 2:157299454-157299476 ACATCTGTACGGGAGGTAGGAGG - Intronic
948600758 2:239106339-239106361 GCACATGTAGGGGAGGGACAAGG + Intronic
1169134652 20:3190053-3190075 CCATTTGCAGGGCAGGTAGAAGG - Intergenic
1169196675 20:3686865-3686887 CCATCTGTAGGAGGGGGCCAGGG - Intergenic
1171181570 20:23094719-23094741 CCAGCAGGAGGGGAGGAACATGG + Intergenic
1173582364 20:44156506-44156528 TCATTTGTAGGGGAAGTCCAAGG + Intronic
1174587514 20:51620407-51620429 TCACCTGTAGGGGAAATACAGGG + Intronic
1178912033 21:36682790-36682812 CCATCTCTAGTGCAGGTACCAGG + Intergenic
1179070109 21:38063649-38063671 CCATGTGTCGGGGAGGGACCTGG - Intronic
1179983934 21:44910843-44910865 CCAGCTGGAGGGGAGCTTCATGG - Intronic
1182071292 22:27465599-27465621 CCAGCTGTAGGGAAGGCACCAGG - Intergenic
951706831 3:25552125-25552147 CCCTCTGTAGTCAAGGTACATGG + Intronic
953244511 3:41178396-41178418 CCATCTTTGGGGGAGTTCCATGG + Intergenic
965085973 3:164098854-164098876 CCTACTGTAGGGGAGGTGGAGGG - Intergenic
965417191 3:168411040-168411062 CCATCTGCAGGAGAGGAAAAGGG + Intergenic
970384696 4:15544380-15544402 TCCTCTGTAGGGGAGGAACAGGG - Intronic
975373925 4:73620435-73620457 TCACCTGTAGGGGAGGTCCGAGG + Exonic
978399598 4:108316624-108316646 CCATCTGTAGGTGAACTCCATGG - Intergenic
979403973 4:120286136-120286158 CCATCTCTAGGGAAGCCACATGG + Intergenic
979557924 4:122072108-122072130 CCATATGGTGGGGAGGTAAAGGG + Intergenic
985339127 4:188929874-188929896 AGATCTGTAGGGAAGGGACAAGG - Intergenic
988470227 5:31531004-31531026 CTTTCTGTTGCGGAGGTACATGG - Intronic
991290260 5:65027032-65027054 CCAGCTGTAGAGGAGATAGAAGG + Intergenic
991987575 5:72305860-72305882 TGATTTGTTGGGGAGGTACAGGG - Intronic
992508240 5:77408634-77408656 CAATCTGTAGAGGAGGGCCAGGG + Intronic
995897104 5:117027556-117027578 CCATGAGTAGGGTAGCTACAGGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1005835976 6:29709940-29709962 CCCTGTGCAGGGGAGATACAAGG + Intergenic
1007697918 6:43745173-43745195 CCAGCCGAAGGGGAGGTAGACGG + Intergenic
1010002321 6:70959559-70959581 TCATCTGTTGGGGAGCTTCATGG + Intergenic
1010966357 6:82213813-82213835 CCTTTTTTTGGGGAGGTACATGG - Intronic
1014896903 6:126912445-126912467 CCATCGGTAGGGATGGTACCAGG - Intergenic
1015604078 6:134937801-134937823 TCTTTTGTAGGGGAGGAACATGG + Intronic
1016066109 6:139684812-139684834 AGATATGTAGGGGAGGAACAAGG - Intergenic
1019068983 6:169325998-169326020 TCATCTGTAGGGGAGATTCCAGG - Intergenic
1022041431 7:26585648-26585670 CCATCTGTGGGGGAGGACTAAGG - Intergenic
1022526208 7:31039032-31039054 CCATCTGTGGAGGTGGAACACGG + Intergenic
1024095538 7:45979664-45979686 CCATCTGTAGGACAGGAGCAGGG + Intergenic
1024246216 7:47472289-47472311 CCATCTGTAGGGGAGGTACAGGG - Intronic
1026634498 7:72069593-72069615 CCCTCTGCAAGGGAGGCACAGGG - Intronic
1029162633 7:98563460-98563482 CCTGCTGTAGGGGAGGAGCATGG + Intergenic
1033318114 7:140315374-140315396 CCCTCTGTGAGGGAGGAACAAGG + Intronic
1034378024 7:150663916-150663938 CCATGTGTAGGGAGGGGACATGG + Intergenic
1038913529 8:31994052-31994074 CCATCTTAAAGCGAGGTACAGGG + Intronic
1039880466 8:41622273-41622295 GCTTCTGCAGGGGAGGGACAGGG + Exonic
1047338569 8:123958416-123958438 CCTCCTGTAGGTGAGGGACAGGG - Intronic
1054715020 9:68548359-68548381 CCCTCTGTAAGGGAGGATCAGGG - Intergenic
1060209254 9:121699930-121699952 ACATCTGGAGGGGAGGAGCAGGG + Intronic
1061294866 9:129671591-129671613 CCATCTGTGGGATAGGAACAAGG + Intronic
1194759503 X:97777593-97777615 GCATATGTAGGGGAGATACCAGG + Intergenic