ID: 1024246265

View in Genome Browser
Species Human (GRCh38)
Location 7:47472575-47472597
Sequence CTGTGTGTAGGGAGCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024246265_1024246272 12 Left 1024246265 7:47472575-47472597 CCCTGGCAGCTCCCTACACACAG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 1024246272 7:47472610-47472632 ATTCGCTTAAGCCACTCTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 65
1024246265_1024246274 21 Left 1024246265 7:47472575-47472597 CCCTGGCAGCTCCCTACACACAG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 1024246274 7:47472619-47472641 AGCCACTCTCTAGGGACTAGAGG No data
1024246265_1024246273 13 Left 1024246265 7:47472575-47472597 CCCTGGCAGCTCCCTACACACAG 0: 1
1: 0
2: 2
3: 29
4: 282
Right 1024246273 7:47472611-47472633 TTCGCTTAAGCCACTCTCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024246265 Original CRISPR CTGTGTGTAGGGAGCTGCCA GGG (reversed) Intronic
900537876 1:3187703-3187725 CTGCCTGCTGGGAGCTGCCAAGG - Intronic
900551387 1:3257941-3257963 CTGTGGGTGGGGAGCTGTCCTGG + Intronic
900848968 1:5126989-5127011 CTCTGTCTAGGCAGCTGGCAGGG + Intergenic
901161221 1:7177774-7177796 CTGTGTGTAGGGAGGAGCCTTGG - Intronic
901594917 1:10377343-10377365 TTGTGTGAAGGGAAATGCCAAGG + Exonic
901830405 1:11888695-11888717 CAGTGTGTCGGGACCTGGCAGGG + Intergenic
902955476 1:19922055-19922077 CTGTGGGTAGGGAGATACCTGGG + Intronic
903181114 1:21605317-21605339 CTGTGTGTCCGCAGCAGCCAGGG - Intronic
903690937 1:25173141-25173163 CTGTGTGCAAGGTGCTGACATGG + Intergenic
904261684 1:29291272-29291294 CTGGGAGTAGGGAGAAGCCAAGG + Intronic
905054052 1:35077892-35077914 CTGTGTTTAGGTAGCGGGCAAGG + Intronic
905307125 1:37027540-37027562 CTGGGTGTAGGGTGATGCTAGGG - Intronic
905453613 1:38072916-38072938 CTGTGAGCAGGGAGCAGCCATGG + Intergenic
905858192 1:41328969-41328991 CTGTGTGTGGGCAGGAGCCACGG + Intergenic
909107933 1:71435965-71435987 CTGTGTGTAGTGAGCTTTAAAGG - Intronic
910578205 1:88791446-88791468 CTGTGTGTGTGGAGTTGCCCAGG + Intronic
912524821 1:110273744-110273766 GTGTCTGTAGGGAGGTGCCCTGG + Intronic
912680536 1:111726316-111726338 CAGTGTGTAAGGAGCAGCCAGGG - Exonic
912722344 1:112030760-112030782 CTGTGTGCTGGGGGCTGTCAGGG - Intergenic
914377621 1:147086139-147086161 CTGTGTCTAGGCAGCAGACAAGG - Intergenic
915642045 1:157235327-157235349 CTCTGTGTAGGCAGCGGGCAAGG + Intergenic
916590350 1:166184205-166184227 CTGTGTGAAGGTTGCTGACAAGG - Intergenic
918148499 1:181778781-181778803 CTGTGTTCAGAGAGCAGCCAGGG - Intronic
920210555 1:204325316-204325338 CTGGGTTTAGAGGGCTGCCAGGG + Intronic
920283081 1:204858785-204858807 CGGTGGGGAAGGAGCTGCCATGG - Intronic
920371479 1:205481916-205481938 CTGTGTGTCGGGACATGCCAGGG + Intergenic
921402635 1:214743141-214743163 CATTGTTTGGGGAGCTGCCATGG - Intergenic
1065490707 10:26279003-26279025 CTCTCTGGAGGCAGCTGCCACGG + Intronic
1066459998 10:35604844-35604866 CAGTGAGTAGGGGGCTGCCCCGG + Intergenic
1067768692 10:49108449-49108471 CTGTGGGTGGGGAGCCGCCCTGG + Intronic
1067829543 10:49602529-49602551 CTGTGTGCAGGGGACTGCCTCGG - Intergenic
1067836645 10:49645603-49645625 CCCTGTGGAGGAAGCTGCCAGGG + Intronic
1068985790 10:63106610-63106632 CTCTGTTTAGGCAGCTGGCAAGG + Intergenic
1069418320 10:68222513-68222535 CTTTCTGTAGGGAGATTCCAGGG + Intergenic
1069574648 10:69517762-69517784 CTGTGAGGAGGGCTCTGCCAGGG + Intergenic
1069696617 10:70391073-70391095 CTGTGTCTAGGCAGCAGGCAAGG + Intergenic
1071318780 10:84430531-84430553 CTTTTTCTAGGGAGCGGCCAGGG + Intronic
1071357543 10:84812927-84812949 CTCTGTGTAGGCAGCAGGCAAGG - Intergenic
1072435557 10:95411876-95411898 CTGTGTGTTGGGAGCTGTCCTGG - Intronic
1072696430 10:97607192-97607214 CAGTGTGTAGGGAGCAGCCAGGG - Intronic
1073109087 10:101050251-101050273 CTGTGAGGAGGGAGCTGGCTGGG + Intergenic
1073117440 10:101099549-101099571 CTGTGTTTGGGCAGCAGCCAGGG - Intronic
1073467685 10:103703883-103703905 CTGTGTGTGTGTAGCTGCCTAGG + Intronic
1075563044 10:123482255-123482277 CAGTGTGTAATGAGGTGCCAGGG - Intergenic
1076137734 10:128056572-128056594 CTGAGGGAAGGGAGCTGCCCAGG - Intronic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076705701 10:132300370-132300392 CTGTGAGGAGGGAGCCCCCATGG - Intronic
1076735427 10:132456920-132456942 CTGCGTGAAGGAAGCTGCCTTGG + Intergenic
1076850793 10:133091740-133091762 GTGTGTGTAGGGAGCTCCTTGGG + Intronic
1076988607 11:257293-257315 CTGAGAGGAGGGAGCTGGCAGGG + Intergenic
1077086929 11:757638-757660 CTGTGTGTAGTGGGCTAACAAGG + Intronic
1077094667 11:794244-794266 GTGGGGGTGGGGAGCTGCCACGG + Intronic
1077379015 11:2219543-2219565 CTGTGGGAATGGGGCTGCCAGGG - Intergenic
1078454629 11:11465489-11465511 CTGTGGCTACTGAGCTGCCATGG - Intronic
1078545298 11:12242552-12242574 CTGTGTGTGGTGAGCAGGCAAGG + Intronic
1081644955 11:44783844-44783866 CTCTGTGAAGGCAGCTGCCAGGG - Intronic
1081734883 11:45395667-45395689 CTGTTTGTAGGGAGCAGGCCGGG + Intergenic
1081914189 11:46720249-46720271 CTGTCTGTAGGGCTCTGCCAGGG + Intronic
1084378962 11:68798540-68798562 CTGTGTGCGGGGAGCTGGCTGGG - Intronic
1084486142 11:69449454-69449476 CTGTGTCCAGGGCTCTGCCACGG + Intergenic
1084515155 11:69634011-69634033 CGGGGTCTAGGGAGCAGCCAGGG + Intergenic
1084890838 11:72236103-72236125 CTCTGTGGTTGGAGCTGCCATGG + Intronic
1085399596 11:76227737-76227759 CTGCCTGCATGGAGCTGCCATGG - Intergenic
1087444502 11:98232217-98232239 ATATGTGTAGTGAGATGCCAGGG - Intergenic
1088253400 11:107880923-107880945 CTCTGTCTAGGCAGCTGGCAAGG + Intronic
1088701573 11:112417712-112417734 CTATGTGTTGGGCACTGCCAGGG + Intergenic
1089612950 11:119679793-119679815 CTAGGTGGAGGGAGCTGCCTGGG - Intronic
1090183136 11:124718297-124718319 CTTTGTGTGGGGAGCTGCTCTGG + Intergenic
1091754031 12:3040293-3040315 CTGTGTGTGGGTAGCAGCCATGG + Intronic
1092547214 12:9462465-9462487 TTGTCTGTTGGGAGCTGACAGGG + Intergenic
1092704717 12:11269715-11269737 CTTTATAAAGGGAGCTGCCATGG - Exonic
1093181773 12:15975061-15975083 CTCTGTGTAGGCAGCAGGCAAGG - Intronic
1094267350 12:28574186-28574208 CAGTGTGCTGGGTGCTGCCATGG + Intronic
1094505726 12:31059599-31059621 TTGTCTGTTGGGAGCTGACAGGG - Intergenic
1094842275 12:34347130-34347152 GTGGGTGTTGGGAGGTGCCAGGG + Intergenic
1096518494 12:52171234-52171256 CTGTGTTTTGTGGGCTGCCAGGG - Exonic
1097187185 12:57202202-57202224 GTGTGTGTGGGCAGCTGCCTTGG - Intronic
1097190571 12:57217472-57217494 CTCTGTGTCGGGAGCATCCATGG + Intronic
1098661197 12:73095774-73095796 TCATGTGTAGAGAGCTGCCAAGG - Intergenic
1100767275 12:97881141-97881163 TTGTGTTTATGGGGCTGCCATGG - Intergenic
1101697733 12:107142232-107142254 CTGTGTGTTGAGAGTTGCCCTGG + Intergenic
1101845284 12:108358608-108358630 GTGTGTGCTGGGAGCTGACATGG - Intergenic
1103971765 12:124677165-124677187 CTGTCTGAATGCAGCTGCCAAGG + Intergenic
1104384510 12:128338877-128338899 CTCTGTGTAGGGAACTTCTAAGG - Intronic
1104421245 12:128637397-128637419 CAGCTTGTAAGGAGCTGCCATGG + Intronic
1104946467 12:132416983-132417005 CTGGGTGTTGGGGGCTGGCAGGG - Intergenic
1105812114 13:24004671-24004693 CTGTGTGTATGGAGCAGTCTCGG - Intronic
1105927924 13:25024348-25024370 CTGTGTGTATGGAGCAGTCTCGG - Intergenic
1107295934 13:38907545-38907567 CTGTGTGTATGGAGTTTACATGG + Intergenic
1108585064 13:51863846-51863868 CTTTCTGGAGGAAGCTGCCAGGG - Intronic
1108689623 13:52849059-52849081 CTGTGGGTAGGGGGCTGCAAGGG - Intergenic
1110569596 13:76990151-76990173 CTGTGTGCAGGGAGCTTTCATGG - Intergenic
1111131362 13:83980634-83980656 CAGTGTGTAGGAAGTTGCTAAGG + Intergenic
1111645367 13:91025489-91025511 CTCTGTGTAAGGTGCTGCCTTGG - Intergenic
1113022662 13:105905652-105905674 CTGTGTGTACTGATCTACCAAGG + Intergenic
1114035998 14:18627846-18627868 GTGTGTGTTGGGCGATGCCAAGG - Intergenic
1114694745 14:24616156-24616178 CTGTGAGGAGGGAGTAGCCAGGG + Intergenic
1114883157 14:26812223-26812245 ATGTGTTTAGGGAGCAGCCAAGG + Intergenic
1115627212 14:35205740-35205762 CTGTGTGTATGAAGCCACCATGG - Intronic
1116669336 14:47821263-47821285 CTGTGTGTGCTGAGCTGCCTGGG + Intergenic
1117288213 14:54307803-54307825 TTGTGTGTGGGCAGCAGCCATGG - Intergenic
1118168403 14:63360555-63360577 CTTTGTGTAGCAAGCAGCCATGG + Intergenic
1119853273 14:77881320-77881342 CTGGGAGAAGTGAGCTGCCACGG - Intronic
1122299057 14:100721743-100721765 CTGTGCGTGGGGTGCTCCCAGGG - Intergenic
1122380192 14:101297990-101298012 CTCTGTCTAGGCAGCTGACAAGG - Intergenic
1123036098 14:105472598-105472620 GGGTGTGAAGGGAGCTGGCAGGG - Intergenic
1124183473 15:27500319-27500341 CTGTGTGTCGGGTGCTGTCTTGG - Intronic
1124354361 15:28984136-28984158 CTGGGTGTAGGGTCCTGCCCTGG + Intronic
1124514436 15:30354624-30354646 GGGTGGGTATGGAGCTGCCATGG - Intergenic
1124728484 15:32176141-32176163 GGGTGGGTATGGAGCTGCCATGG + Intergenic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125185358 15:36923849-36923871 CTGTATGGAGGGAGGTGACATGG - Intronic
1125844898 15:42843187-42843209 CTGTGTGTAGGGATGAGCAAAGG - Intronic
1125883723 15:43213479-43213501 CAGTTTGTAGGGACCTGCCTAGG - Intronic
1126378212 15:48018044-48018066 CTGTGTTCAGTAAGCTGCCAGGG - Intergenic
1126465023 15:48954137-48954159 CTGTGTTGTGGGAGCTGCCCTGG + Intronic
1128074620 15:64818424-64818446 CTGAGGGCAGGGAGCTGTCATGG + Intronic
1128351743 15:66895323-66895345 CTCTGTCTAGGCAGCTGGCAAGG - Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1130201842 15:81838247-81838269 CACAGTGTAGGGAGGTGCCAAGG - Intergenic
1130596794 15:85254680-85254702 CTGTGGGTAGGCAGGTGCCAAGG + Intergenic
1131364220 15:91824188-91824210 CTGTCTGTTGGGGGCTGCCCTGG - Intergenic
1132622441 16:874262-874284 CTGTGTGTGCGGGGCTGGCAGGG + Intronic
1133150007 16:3820962-3820984 CTAACTGTAGGGACCTGCCAAGG - Intronic
1133680134 16:8113510-8113532 CTGTGTCTAGGCAGCGGGCAAGG + Intergenic
1136356881 16:29750014-29750036 CTATGTGTAGGCAGCGGGCAAGG + Intergenic
1138544882 16:57711593-57711615 CTCTGTCTAGGCAGCTGGCAAGG - Intronic
1138966280 16:62087727-62087749 CTCTGTCTAGGCAGCAGCCAAGG + Intergenic
1141693692 16:85610379-85610401 CTGTGGGTAGGGCGCTGCTTAGG + Intergenic
1142894281 17:2964183-2964205 CTGTGGGAGAGGAGCTGCCAGGG + Intronic
1143466876 17:7143070-7143092 CTGTGTCTAGGCAGCAGGCAAGG + Intergenic
1143605436 17:7982143-7982165 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1144395657 17:14840470-14840492 CTGAGGGTAGGGTGCTGGCATGG - Intergenic
1145265087 17:21376230-21376252 GTGTGTGTAGGGGGCGGCCCGGG + Exonic
1146845005 17:36176889-36176911 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146857312 17:36264824-36264846 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1146863304 17:36323551-36323573 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1146873224 17:36388734-36388756 CTGGGGTTAGGGAGCAGCCATGG - Intronic
1146880580 17:36439820-36439842 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147066164 17:37924139-37924161 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147076106 17:37989359-37989381 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1147077697 17:38003700-38003722 CTGAGGTTAGGGAGCAGCCATGG + Intronic
1147087631 17:38068905-38068927 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1147093634 17:38127634-38127656 CTGAGGTTAGGGAGCAGCCATGG + Intergenic
1147103573 17:38192854-38192876 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1148189095 17:45666449-45666471 CTGTGTGTTGGTAGCCTCCAAGG + Intergenic
1148474105 17:47915907-47915929 CTGTCTGTGGGGTGCTGCCAGGG + Intronic
1148965858 17:51435510-51435532 CTGTGTCTAGGCAGCGGGCAAGG + Intergenic
1149848152 17:60019372-60019394 CTGAGGTTAGGGAGCAGCCATGG - Intergenic
1149862024 17:60127173-60127195 CTGAGGTTAGGGAGCAGCCAGGG + Intergenic
1150086504 17:62275954-62275976 CTGAGGTTAGGGAGCAGCCATGG - Intronic
1151907510 17:77058278-77058300 CTGTGTGTTGGGAGCTCGAAGGG + Intergenic
1152397614 17:80043937-80043959 CTGGGAGTAGGGGGCAGCCAAGG - Intronic
1152636168 17:81431310-81431332 CTGGGGGTTGGGAACTGCCAGGG - Intronic
1152885114 17:82845068-82845090 GTGTGTGTTGGGGGGTGCCAGGG + Intronic
1153433254 18:5041508-5041530 TTGTGTGCAGGCAGCTCCCAAGG + Intergenic
1154308409 18:13247653-13247675 GTGCGTGGAGGGTGCTGCCAGGG - Intronic
1156228982 18:35135825-35135847 CTGTGTGTACAGAGCTGAGATGG + Intronic
1158572895 18:58611904-58611926 CAGCGTGCAGTGAGCTGCCAGGG - Intronic
1158875446 18:61730061-61730083 CTGTGAGTAGGGAGCAGGGATGG - Intergenic
1158887911 18:61846281-61846303 CTGTCTTTGGGGAGCTTCCATGG + Intronic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1160319577 18:77877587-77877609 ATGTGTGTGGGGAGCTGCCTGGG - Intergenic
1160745913 19:710503-710525 CTGTGGGGAGGGGGCTGCCTAGG + Intronic
1162392220 19:10396406-10396428 CTGTGAGATGGGAGCCGCCAGGG - Intronic
1162421776 19:10569478-10569500 CTGTGTGCAGGGAGCGTCCTGGG + Intergenic
1163294663 19:16404548-16404570 CTGTGCATAGGGCGCTGCCCCGG + Intronic
1165198014 19:34121319-34121341 CTGTGTGTATGGGGCTGTTAGGG - Intergenic
1166504024 19:43360446-43360468 TGGGGTGGAGGGAGCTGCCAGGG - Intronic
1166506433 19:43374312-43374334 TGGGGTGGAGGGAGCTGCCAGGG + Intergenic
1166664782 19:44672629-44672651 CTGGATGTAGAGAGCTGCCTGGG - Exonic
1166933892 19:46319484-46319506 CTGTGTGAAGGGAGGTGCCAGGG + Intronic
1166997016 19:46724443-46724465 CTGTGTGTGGGGATCCGCCAGGG - Intronic
1167529957 19:50009006-50009028 CTGTGTGCAGGGAGGGGCCGGGG + Intronic
1168331515 19:55572572-55572594 CTGTGTGGTGGGAGCTGACGGGG + Intergenic
1168625672 19:57916170-57916192 CTCTGTCTAGGCAGCTGGCAAGG + Intronic
1168724534 19:58573457-58573479 CTTCCTGTAGGGAGTTGCCATGG - Exonic
925675922 2:6360904-6360926 GTGTGTGTAGGGAGCTGGAAAGG + Intergenic
926621626 2:15051311-15051333 TTGTGTGCAGGGAGCTGGCCAGG + Intergenic
926755072 2:16227918-16227940 CTGTGTTCAGGGACCTCCCATGG - Intergenic
926911620 2:17857040-17857062 CTGTTTGCAGGGAGCACCCAAGG - Intergenic
927460437 2:23294030-23294052 CTGTGTGCAGGTCGCTGCCGTGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
931418288 2:62101830-62101852 CAGTGTTTAGAGAGCTACCAAGG - Intronic
931775090 2:65533319-65533341 CTGTGAGGTGGGAGCAGCCAGGG + Intergenic
933609805 2:84422232-84422254 CTGTGTTTTGGGAGCTCGCATGG - Intergenic
937572082 2:123376180-123376202 CTGGGAGTAGGGAGGTGTCAGGG + Intergenic
938008787 2:127811562-127811584 CTGTGTGCCGGGATCTGCCAGGG - Intergenic
938288908 2:130139183-130139205 CTGTCTGCAGGGACCTGCCTGGG - Intergenic
938312907 2:130305489-130305511 GTGTGTGCAAGGAGCAGCCATGG - Intergenic
938467625 2:131533748-131533770 CTGTCTGCAGGGACCTGCCTGGG + Intergenic
940338359 2:152552775-152552797 GTGTGAGTAGGCAGATGCCATGG + Intronic
941998798 2:171626543-171626565 CTGAGTGCAGGGAGAGGCCAGGG - Intergenic
944442941 2:199761124-199761146 CTCTGTGCAGGGAGCAGTCAGGG - Intronic
946830072 2:223719819-223719841 CTCTGTGTAGGCAGCAGGCAAGG - Intergenic
947216319 2:227753385-227753407 CTCTGTCTAGGCAGCTGGCAAGG + Intergenic
947339984 2:229128022-229128044 TTGTGTGCAGGGAGATGGCAGGG + Intronic
948031510 2:234821525-234821547 GGGTGTGTAGGGAGCTGCGCTGG - Intergenic
948396791 2:237650533-237650555 CAGTGTGAAGGGTGCTCCCAGGG - Intronic
948489566 2:238303779-238303801 CTGTTGGTACAGAGCTGCCAGGG - Intergenic
948720715 2:239898405-239898427 GTGTGTGTAGGCAGCTCCCTCGG - Intronic
948845652 2:240681707-240681729 CTGAGTGGAGGGAGCTCACAAGG + Intronic
948848203 2:240693023-240693045 CTGAGTGGAGGGAGCTCACAAGG - Intronic
1169208767 20:3754252-3754274 CTGGAGGTAGGGACCTGCCAAGG + Intronic
1169263621 20:4154826-4154848 GGATGTGTAGGGAGCTGCCGGGG + Intronic
1169440639 20:5631122-5631144 CTCTGTCTAGGCAGCTGGCAAGG - Intergenic
1170797351 20:19560471-19560493 GTGTGGGTAGGAAGCTGTCATGG + Intronic
1173854338 20:46240443-46240465 CTGTGTGGAGGTTGTTGCCAAGG + Intronic
1175524239 20:59622632-59622654 CTGTGTGCAGCGAGGTGCCGGGG - Intronic
1175896788 20:62339995-62340017 CTGTGTGCAGGGAGCTGGGGTGG + Intronic
1175960504 20:62634260-62634282 CTGTGTCTGAGGAGCTGCAAGGG - Intergenic
1176125873 20:63474385-63474407 GCGTGTGCAGGGAGATGCCACGG - Intergenic
1178602694 21:34008632-34008654 CTCTGTCTAGGCAGCTGGCAAGG - Intergenic
1179456947 21:41506953-41506975 CTGTGGGCAGGGAGCACCCAGGG - Intronic
1179710079 21:43208201-43208223 ATGTGTGTGGGGGGCTGCCTGGG + Intergenic
1180855666 22:19043275-19043297 CTGTGTGTTGGGGGCTGTCCTGG - Intronic
1180980699 22:19876801-19876823 CTGTGTGTGGGGAGCAGCTGTGG + Intronic
1181019382 22:20090993-20091015 CCCTGTGCAGGGAGCTGCCTGGG + Intronic
1181759617 22:25049219-25049241 CTGTGTTTCAGGTGCTGCCACGG + Exonic
1182295608 22:29309920-29309942 CTGGGTCCAGGGAGCTGCCCAGG - Intronic
1182718064 22:32376048-32376070 CTCTGTGGAAGGAGCTGCCCAGG + Intronic
1183172663 22:36199262-36199284 CTGTGGGTAGGAACCAGCCAGGG + Intronic
1184306644 22:43607388-43607410 CTGTCTTTGGGGAGCTGTCAGGG - Intronic
1184572692 22:45336426-45336448 CTTTTTGTGGGGAGCTGCCTCGG + Intronic
1185145637 22:49134281-49134303 CTGGGTGTAGGCAGCGGGCAAGG + Intergenic
950069316 3:10139480-10139502 CTCTGTGCAGTGAGCTGTCAAGG + Intergenic
952422494 3:33144632-33144654 CTGTGTGAAGGGATCTGGCAGGG + Exonic
953438870 3:42900996-42901018 CTGTGTCTAGGCAGCAGGCAAGG - Intronic
953617249 3:44502393-44502415 CAGTGTGTATGGAGCTGCCTGGG - Intronic
953906401 3:46870471-46870493 CTGGGTGTAGGGGGCCACCATGG - Intronic
954712317 3:52511320-52511342 AAGTGTGTAGGTACCTGCCAAGG - Intronic
955002088 3:54937008-54937030 CTGTGTGTGAGGAGGTGCTAAGG + Intronic
955391476 3:58525458-58525480 CTGTGTGGAGGAAGCTGACTTGG + Intronic
955590581 3:60530636-60530658 CAGTTGGTAGTGAGCTGCCAAGG - Intronic
956916952 3:73881604-73881626 ATGAGTGTAGAGTGCTGCCAGGG + Intergenic
961470798 3:127110313-127110335 TGGTGTGCAGGGAGCTTCCAAGG + Intergenic
961953202 3:130772092-130772114 TTGTGTGTGGGTAGGTGCCAGGG - Intergenic
964366188 3:155953191-155953213 CTCTGTGTAGGCAGCAGGCAAGG - Intergenic
966298644 3:178453566-178453588 CTGTGTGTATGTGGTTGCCAGGG - Intronic
967865537 3:194187062-194187084 CTGTGTGCAGGGGCCTCCCACGG - Intergenic
967865685 3:194187988-194188010 CTGTGTGCAGGGGCCTCCCACGG + Intergenic
967915469 3:194575122-194575144 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
968485315 4:858110-858132 CTGTGTGGAGGAGGCTCCCACGG + Intronic
972344444 4:38181221-38181243 ATGTGTGTATGGATCTGCAAAGG - Intergenic
976217572 4:82729479-82729501 CTGTGTGCTGGGAGATGCCGGGG - Intronic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
984364112 4:178776030-178776052 CTGTGTGAAGGTAGCTGGCATGG + Intergenic
987280784 5:16411711-16411733 TTGTGAGGAGGGAGCTGCCTTGG + Intergenic
990207002 5:53440521-53440543 CAGTGTGTAAAGTGCTGCCATGG + Intergenic
992639398 5:78755959-78755981 CTGTGGGTTGGGCTCTGCCAGGG + Intronic
993478545 5:88394781-88394803 CTGTGTGTGGAGAGCAGCTATGG + Intergenic
998812339 5:145978880-145978902 CTGTGTGTGGGGAGAGGCCCTGG + Intronic
1001650898 5:173315754-173315776 CTGTGTGTCAGGCTCTGCCATGG - Exonic
1001997007 5:176170228-176170250 CTGTGTTTGGGGAACAGCCAGGG - Intergenic
1002027450 5:176405072-176405094 CTCTGTGTAGGCACCAGCCAAGG - Intronic
1002493554 5:179596845-179596867 CTGTGGGGAGGGAGCTCCCTAGG - Intronic
1002960186 6:1906918-1906940 CTGTGTGCAGGGAGCCCCTACGG - Intronic
1004230855 6:13831773-13831795 CTGTGGGAAGAGAGCTGCCACGG + Intergenic
1006294304 6:33163185-33163207 CTGTGTGTAGGGGGGTTTCAGGG - Exonic
1006516707 6:34549535-34549557 CTGTGGTTCGGGAGCTGTCAGGG - Intronic
1006896235 6:37472843-37472865 CAGGGTGAAGGGAGCTGCCAGGG + Intronic
1008612375 6:53196268-53196290 CTGTGTCTAGGCAGCAGGCAAGG + Intergenic
1012144034 6:95659088-95659110 CTGTGTGAAGCTAGTTGCCATGG + Intergenic
1012991010 6:105925903-105925925 CTGTGGGAAGCCAGCTGCCATGG - Intergenic
1014211473 6:118712768-118712790 CTGTGTGTAGAGAGCACCCAAGG + Intergenic
1015869703 6:137763632-137763654 CTGTGTGTGCGCAGTTGCCATGG - Intergenic
1016619503 6:146091559-146091581 GTGTGTTCAGGGAGCAGCCAGGG + Intronic
1016818240 6:148323561-148323583 CTCTGTGAAGGGAGGGGCCATGG - Intronic
1018619727 6:165718483-165718505 CTGTGTGTAGTGAACGGACAAGG + Intronic
1018730155 6:166643923-166643945 CTGTGTATAGTGATTTGCCAAGG - Intronic
1019147746 6:169985771-169985793 CTGAGTGAGGGGAGATGCCATGG + Intergenic
1019363664 7:619229-619251 CTGTGTGTGGGGATCTGGCCTGG - Intronic
1019470921 7:1220239-1220261 CTGTGTGTAAGTAGCTGGAAGGG + Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1020941390 7:14542868-14542890 CTGTGTTTACGGAGATCCCAGGG + Intronic
1021964845 7:25907262-25907284 GTGTGTGGATGGAGCTGCAATGG - Intergenic
1022095716 7:27139752-27139774 CTGTGTGTGGGGACCTGGCAGGG - Intronic
1024246265 7:47472575-47472597 CTGTGTGTAGGGAGCTGCCAGGG - Intronic
1027408307 7:77886392-77886414 CTTTGTCTAGGTATCTGCCAAGG - Intronic
1028170706 7:87592127-87592149 GTGTGTGAAGGGAGCTGGCAGGG + Intronic
1028382110 7:90211640-90211662 CTGTGTGGAGGGAGCTGGGAAGG - Intronic
1030364261 7:108627602-108627624 CTCTGTCTAGGCAGTTGCCAAGG - Intergenic
1035572062 8:679216-679238 CTGTGAGTTGGGAGCTGTGAGGG - Intronic
1035730951 8:1853268-1853290 CTCTGGGTAGGCAGCTGGCAGGG - Intronic
1037670316 8:21009836-21009858 CTCTGTCTAGGCAGCAGCCAAGG + Intergenic
1041757993 8:61334808-61334830 CTCTGTCTAGGCAGCTGGCAAGG - Intronic
1043355359 8:79405097-79405119 TTGTGTGTTGGGAGATGCTATGG - Intergenic
1043570636 8:81599116-81599138 CTGTATGTAGGCAGCAGGCAAGG - Intergenic
1048337953 8:133517019-133517041 CAGTGGGCAGGAAGCTGCCAAGG - Intronic
1048997784 8:139804809-139804831 CTGTGGGGAGAGAGCTGCCTTGG - Intronic
1049353153 8:142174900-142174922 ATGTATGTAGAGAGATGCCATGG - Intergenic
1049638846 8:143705328-143705350 CTGTGTGTAGGGAGGTGCACGGG + Intronic
1051362412 9:16293074-16293096 CTGTGTGCTGGGGGCTCCCATGG - Intergenic
1052573047 9:30253681-30253703 CTGTGTGTATGTATCTGCAAGGG - Intergenic
1053302305 9:36960799-36960821 GTGTGGGCAGGGAGCTGCAAGGG - Intronic
1054998623 9:71422888-71422910 GTCTGTGTAGGGAGCTGATAAGG - Intronic
1055688841 9:78808247-78808269 GTGTGTCTGGGGTGCTGCCAGGG + Intergenic
1056221047 9:84451054-84451076 CTCTGTCTAGGGAGCGGGCAAGG + Intergenic
1061179377 9:129014714-129014736 CTCTGAGGAGGGAACTGCCATGG + Intronic
1062316583 9:135970312-135970334 ATGTGTGCAGTGAGCTGCCACGG - Intergenic
1062373703 9:136252727-136252749 CTGTGTGGAGAGAGCTGCTAAGG + Intergenic
1062475400 9:136724239-136724261 CTGTGTTTGGGGAACTGCCCTGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187112267 X:16314036-16314058 CTGTGTCTAGGCAGCGGGCAAGG - Intergenic
1189550685 X:42089321-42089343 CTCTGTCTAGGCAGCTGGCAAGG + Intergenic
1189784893 X:44550458-44550480 CTCTGTGTAGGCAGCGGGCAAGG + Intergenic
1192198520 X:69048420-69048442 CTGTGGGAGGGGAGCTGTCATGG - Intergenic
1192463273 X:71336207-71336229 CTCTGTCTAGGCAGCTGGCAAGG - Intergenic
1192639438 X:72848002-72848024 CTGTGGGTAGTGAGGAGCCAGGG + Intronic
1192642273 X:72872803-72872825 CTGTGGGTAGTGAGGAGCCAGGG - Intronic
1194718240 X:97311325-97311347 CTCTGTCTAGGTAGCTGGCAAGG - Intronic
1195906905 X:109852967-109852989 CTGTGTGTGGGGAGATGCGGGGG - Intergenic
1199993521 X:153004109-153004131 CTGTGTCTAGGCAGCAGGCAAGG + Intergenic