ID: 1024246750

View in Genome Browser
Species Human (GRCh38)
Location 7:47476554-47476576
Sequence AAAAGCCAGAGGTCCCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024246746_1024246750 -1 Left 1024246746 7:47476532-47476554 CCAATTGTCCCTTTATAGTTCTA 0: 1
1: 0
2: 1
3: 26
4: 191
Right 1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 246
1024246748_1024246750 -10 Left 1024246748 7:47476541-47476563 CCTTTATAGTTCTAAAAGCCAGA 0: 1
1: 0
2: 0
3: 28
4: 263
Right 1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 246
1024246744_1024246750 30 Left 1024246744 7:47476501-47476523 CCCATAGAACGGTAATGTAAGCA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 246
1024246747_1024246750 -9 Left 1024246747 7:47476540-47476562 CCCTTTATAGTTCTAAAAGCCAG 0: 1
1: 0
2: 0
3: 10
4: 202
Right 1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 246
1024246745_1024246750 29 Left 1024246745 7:47476502-47476524 CCATAGAACGGTAATGTAAGCAG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG 0: 1
1: 0
2: 3
3: 28
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024246750 Original CRISPR AAAAGCCAGAGGTCCCAATG AGG Intronic
901177376 1:7314329-7314351 AAAGGCCACAGCTCCCAGTGTGG + Intronic
903911017 1:26725167-26725189 AAAAGCCAGAGATTCCACTCTGG - Intronic
906479572 1:46191243-46191265 AGAAGCCAGAGGTCCCTCAGAGG - Intronic
907780148 1:57559440-57559462 AAAGGCCAGAGGTCCCCTTCGGG - Intronic
910561720 1:88598605-88598627 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
910831294 1:91464792-91464814 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
911955979 1:104235728-104235750 AACAGCTAGAGGTCAGAATGTGG - Intergenic
913153359 1:116067756-116067778 AAAAGCCAGATATACCAAAGCGG + Exonic
913496632 1:119433692-119433714 AAAAGCCACAGGAGCCCATGGGG + Intergenic
913498341 1:119448522-119448544 AAAAGCCACAGGAGCCCATGGGG + Intergenic
913501467 1:119476225-119476247 AAAAGCCACAGGAGCCAGTGGGG + Intergenic
913516805 1:119611992-119612014 AAAAGCCACAGGAGCCAGTGGGG + Intergenic
915326415 1:155083256-155083278 CAAAGACAGAGATCCCAGTGTGG + Intronic
917052658 1:170941232-170941254 AAAGGCCATAGGTCCCTTTGTGG + Intronic
917177228 1:172249320-172249342 AAAAGGCAGAGGAACCAAGGTGG - Intronic
917764514 1:178201984-178202006 AAAGGCCAGAGGTCCCTTTGGGG - Intronic
918675493 1:187279787-187279809 TACAGCCAGAGGACCAAATGTGG - Intergenic
919351239 1:196456589-196456611 AATAACCAGAAGACCCAATGGGG - Intronic
919406698 1:197193746-197193768 AAAAGACAGAGGTCACTATATGG + Intronic
923911139 1:238445113-238445135 AAAAGGCAGAGGGCCCACTGAGG + Intergenic
924840963 1:247709195-247709217 AAAGGCCAGAGGTCTCCTTGAGG + Intergenic
1064517844 10:16169626-16169648 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1066163935 10:32765207-32765229 AAAGGCCATAGGTCCCTTTGAGG - Intronic
1067754542 10:48995114-48995136 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1068837445 10:61569994-61570016 AAAAGCCAGAGGTGTCCTTGGGG + Intergenic
1069791030 10:71020970-71020992 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1070542719 10:77428196-77428218 AAAACCAGGAGGTCCCAATGTGG + Intronic
1071480290 10:86060426-86060448 ACCAGCCAGAGCACCCAATGTGG + Intronic
1071986328 10:91054594-91054616 AACAGCCAGAGGCCTAAATGGGG + Intergenic
1074112029 10:110429541-110429563 AATAGCCAGAAGTCTGAATGGGG - Intergenic
1074146408 10:110720864-110720886 AAAAGCCAGAGGTCCCACTATGG + Intronic
1075469853 10:122679954-122679976 AAAGGGCAGAGCTCCCAGTGGGG + Intergenic
1075913799 10:126148869-126148891 AAAAGCCTCAGGACCCATTGTGG + Intronic
1076028614 10:127139023-127139045 AGAACGCAGAGGTCCCAAGGAGG - Intronic
1076927610 10:133500617-133500639 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1077547450 11:3181104-3181126 AAAAGCCTCAGGACCCAAGGGGG + Intergenic
1079920447 11:26427463-26427485 AAAAGCAAGAGGTTCCATTTTGG - Intronic
1081110281 11:39127005-39127027 AAATGCCAGAGGTCTCCTTGAGG - Intergenic
1081418774 11:42847173-42847195 AATAGCCAGGTGTCCCACTGAGG + Intergenic
1081665183 11:44912452-44912474 ACAAGCCTGAGGTCACAGTGTGG + Intronic
1082671509 11:56041649-56041671 AAAGGCCAGAGGTCCCCTTGGGG - Intergenic
1082999432 11:59278138-59278160 AAAGGCCAGAGGTCTCTTTGGGG - Intergenic
1083092943 11:60219702-60219724 AAAGGCCAGAGGTCTCCTTGAGG - Intronic
1084342241 11:68513066-68513088 AAAAGCCTCAGGACCCAAGGGGG - Intronic
1084920898 11:72468932-72468954 AAAGGTCAGAGCTCCCAATCAGG + Intergenic
1085685761 11:78620779-78620801 AAAAGCCAGAGGTCTCCTTGGGG - Intergenic
1086388007 11:86329315-86329337 AAAAGCCAAAATGCCCAATGAGG - Intronic
1086833926 11:91598983-91599005 AAATGCCAGAGGTCTCCTTGGGG - Intergenic
1087410941 11:97789555-97789577 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1087910801 11:103751306-103751328 AAATGCCAAAGGTCACAATGAGG - Intergenic
1088191866 11:107235907-107235929 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1088828343 11:113514749-113514771 AAAAGAAAGAGGTATCAATGAGG + Intergenic
1093032055 12:14297362-14297384 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1093036107 12:14333932-14333954 AAAAGCCAGAGGTGACCTTGGGG - Intergenic
1094523811 12:31218919-31218941 ACAAGGCACAGGTGCCAATGAGG + Intergenic
1096939382 12:55325535-55325557 AAAAGGGAGAGGACCCAAAGAGG - Intergenic
1097621025 12:61940102-61940124 AAAAGCCCCAGGCCCCACTGTGG + Intronic
1098204223 12:68090187-68090209 AAAATCAAGAAGACCCAATGAGG - Intergenic
1098733118 12:74064237-74064259 AAAAGCCAGAGGTCTTCCTGGGG - Intergenic
1098886384 12:75964780-75964802 TTAAGCCAGAGGTTCCAATTTGG - Intergenic
1099526195 12:83721717-83721739 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1100241346 12:92713021-92713043 AAAGGCCAGAGGTCTCCATAGGG + Intergenic
1107983770 13:45757371-45757393 AAAGGCCAGAGGTCACCTTGGGG + Intergenic
1108904096 13:55448563-55448585 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1109516083 13:63443898-63443920 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1111016380 13:82387224-82387246 AAAGGCCAGAGGTCTCTTTGGGG + Intergenic
1111440898 13:88281723-88281745 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1113698944 13:112368634-112368656 GAAAGCCAGAAGTCCAAATTGGG - Intergenic
1115053788 14:29097349-29097371 AAAATCCACAGGGCCCATTGTGG + Intergenic
1115223522 14:31080869-31080891 AAAAGGCAGAGGTTGCAGTGAGG - Intronic
1115530059 14:34318883-34318905 AATGGCCACAGGTCCCATTGAGG + Intronic
1116662767 14:47733067-47733089 AAAAGCCTGAGGACACAGTGAGG - Intergenic
1117539101 14:56729436-56729458 ATCAGCCAGAGTTCCCAAAGTGG + Intronic
1117657022 14:57965710-57965732 AAAGGCTGGAGGTCCTAATGGGG + Intronic
1120110291 14:80546337-80546359 AAAAGCCAGAATTCACAATCAGG + Intronic
1122194823 14:100077071-100077093 AAGTGGCAGAGCTCCCAATGAGG + Intronic
1124783788 15:32660163-32660185 AAAAGCCAGAGGTCCTTACCAGG - Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1126380643 15:48043290-48043312 AAAACCCACATCTCCCAATGTGG + Intergenic
1127356709 15:58207776-58207798 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
1127616090 15:60687204-60687226 AAAAGCCCTAGGATCCAATGGGG + Intronic
1127727542 15:61764689-61764711 CAAAGCCAGAGGCAGCAATGAGG + Intergenic
1128400473 15:67274936-67274958 AAATGGAAGAGGTCCCAAAGGGG + Intronic
1129898767 15:79129552-79129574 AAAAGCCAGAGGGTTCCATGAGG - Intergenic
1130976756 15:88782448-88782470 AAAAGGCAGAGATCCCAATGAGG + Intergenic
1131775884 15:95798167-95798189 ACAAGCAGGAGGTCCCAAGGTGG + Intergenic
1131931633 15:97449100-97449122 AAAAGGCAGAGGGCCCACTGAGG + Intergenic
1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG + Intronic
1133878469 16:9757909-9757931 AAGAGCCAGAGATCCCCATAAGG - Intronic
1135061864 16:19277886-19277908 AAAGGCCATAGGTCCCTTTGGGG + Intergenic
1136392746 16:29975563-29975585 AAAAGCCAGAGGCTCCCATCAGG - Intronic
1137312497 16:47278707-47278729 AAAAGCCAGTAGTGGCAATGGGG + Intronic
1137349324 16:47697570-47697592 AAAATCCAGGGGTCACAATGTGG - Intronic
1137765011 16:50971324-50971346 GAAAGCCAGGGATCCCAAAGTGG - Intergenic
1138425730 16:56931165-56931187 AAAAAACAGATGTCCCAAGGGGG + Intergenic
1139511808 16:67432014-67432036 AAAAGCTAGAGGTCACCGTGAGG + Intronic
1139657743 16:68399254-68399276 AGAAGCCAGAAGTCCCCATGTGG - Intronic
1142132102 16:88435854-88435876 AAAACCCAGGGGGCCCAAGGGGG - Exonic
1142325666 16:89412979-89413001 GACAGCCAGAGCTCCCAATGGGG + Intronic
1146502033 17:33372690-33372712 AATGGCCAGCGGTTCCAATGGGG - Intronic
1148129160 17:45252735-45252757 AAAGGCCACAGTTCACAATGGGG - Intergenic
1149416312 17:56463580-56463602 AAATGTCAGAGGGCCCAAAGAGG + Intronic
1149743186 17:59068121-59068143 AAAAGCCAAAGTTTCCAATAAGG + Intronic
1150408424 17:64921942-64921964 AAAAGGCAGAGGTTGCAGTGAGG + Intergenic
1151190321 17:72393482-72393504 AAAAGACAGGGCTCCCAAAGGGG + Intergenic
1153929366 18:9865254-9865276 GAAGGCAAGAGGTGCCAATGAGG - Intergenic
1156537596 18:37879117-37879139 AAAGGCCAGAGGTCTCCTTGAGG - Intergenic
1159276974 18:66234077-66234099 AAAGGCCAGAGGTTCCTTTGGGG - Intergenic
1160316171 18:77849633-77849655 AAAATCCAGAGGGCCCTGTGTGG + Intergenic
1161539970 19:4844656-4844678 CCAAGCCAGAGGTACCCATGAGG - Exonic
1163358452 19:16829887-16829909 AAAAGCCAGAGGTACCAGCGGGG + Exonic
1165698530 19:37919687-37919709 AAAAGCCTCAGGGCCCAAAGGGG - Intronic
1166509884 19:43398678-43398700 AAAAGACAGAAGGCCCAAAGTGG + Intergenic
1168539551 19:57198781-57198803 AAAAGCCAGAGGTCTCCTTAGGG + Intronic
925521809 2:4754782-4754804 AGAAGGCAGAGGTCCACATGTGG - Intergenic
927627266 2:24734950-24734972 AAGAGACAGAGGTGACAATGGGG + Intronic
927816239 2:26220028-26220050 AATAGCCATAGGTCCCTTTGGGG - Intronic
928453416 2:31398665-31398687 AAAAGCCACGGCTCCCAGTGCGG - Exonic
928497127 2:31844686-31844708 AAAAGAAAGAAGTCCAAATGTGG + Intergenic
929564005 2:42973696-42973718 AAAAGCCACACCTCCCCATGTGG + Intergenic
930308130 2:49702820-49702842 AAAAGCCAGGTGTCAGAATGTGG + Intergenic
930849782 2:55947598-55947620 AAAATCCAGAAGTGCCAAAGAGG - Intergenic
931295602 2:60921880-60921902 AGAAGGCAGAGGTGCCATTGAGG - Exonic
932051543 2:68403385-68403407 AAAAGCCAGAGGCCCCAGTCAGG - Intergenic
933569845 2:83996954-83996976 AAAGGGCAGAGGTCCCAAATAGG - Intergenic
935564512 2:104591675-104591697 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
936592090 2:113813850-113813872 TAGAGGCAGAGTTCCCAATGTGG + Intergenic
936606491 2:113962378-113962400 AAAAGCCAGAGGGAGAAATGAGG - Exonic
936856703 2:116966931-116966953 AAAAGACAGAGGACACAGTGTGG - Intergenic
937021075 2:118656223-118656245 AAGGGCCAGAGATCTCAATGTGG + Intergenic
937515606 2:122651884-122651906 AAACACCAGAGGTCACAATCAGG - Intergenic
941003839 2:160227295-160227317 AAAAGAAAGAGATCCTAATGGGG + Intronic
941330863 2:164175985-164176007 AAAGGCCAGAGGTCTCTTTGGGG + Intergenic
941988304 2:171529778-171529800 AAAAGACAGTGGTTCCTATGGGG - Intronic
942987724 2:182162631-182162653 CAAGGCCAGAGGTCCCTTTGGGG - Intronic
943318039 2:186413064-186413086 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
943707477 2:191050752-191050774 AAAACCCAGAGATGCCAAAGAGG - Intronic
944625964 2:201569110-201569132 AAAGGCCATAGGTCCCTTTGGGG + Intronic
944927701 2:204481967-204481989 TAAAGCCAAAGGTCAGAATGAGG - Intergenic
946058269 2:216919818-216919840 TAAAGCCAGAGTTCTCAAAGTGG + Intergenic
946703981 2:222439197-222439219 AAAGGCCAGAGGTCTCCTTGGGG + Intronic
946951827 2:224884547-224884569 GAAAGCCAAATGTCCAAATGGGG + Intronic
947241128 2:227995627-227995649 AGAAGCCAGAGCCCCCGATGAGG - Exonic
948864877 2:240770175-240770197 AAAAGGCAGAGGCCCCACTGAGG - Intronic
1168867110 20:1096277-1096299 GAAAGCCAGAGGTATCAGTGGGG - Intergenic
1169978146 20:11353548-11353570 AAAAGACAGAGGGCCTATTGAGG + Intergenic
1175065440 20:56282438-56282460 AAAAGACAGAGGTCCCCAGAAGG - Intergenic
1175330991 20:58163771-58163793 GAAAGCCAGAAATCCCAGTGAGG + Intergenic
1177298283 21:19205268-19205290 AGAAGTCAGGGGTCCAAATGAGG - Intergenic
1177505807 21:22015928-22015950 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1178012441 21:28303513-28303535 AAAGGCCAGAGGTCTCTGTGGGG - Intergenic
1178074465 21:29002388-29002410 AAAAGCCAAATGCCCCAGTGGGG + Intergenic
1178475710 21:32935385-32935407 ATAGGACAGAGTTCCCAATGAGG - Intergenic
1179383342 21:40919662-40919684 AAATGCCAGAGGTCCCTTTGGGG - Intergenic
1179415355 21:41193934-41193956 AAAGGCCAGAGGTCTCTTTGGGG + Intronic
1179479697 21:41669420-41669442 ACAAGCCAGAGGCCCCATGGGGG - Intergenic
1183877676 22:40797909-40797931 GAAAGCCAGAGGTGCCCATGGGG - Intronic
1184603765 22:45559802-45559824 AAAGGCCAGAGGTCTCTTTGGGG + Intronic
949639963 3:6025249-6025271 AAAAGCAAAAGGTGTCAATGTGG - Intergenic
951172637 3:19559794-19559816 TAAAGCCAGAATTCCCAGTGTGG - Intergenic
953767349 3:45753717-45753739 TAAAGCCACAGGTCTAAATGAGG - Intergenic
954157690 3:48695656-48695678 AAAAGGCAGAGGTCCCACTACGG + Intronic
955009911 3:55003833-55003855 AAAAGCCAGATCTGCCAAAGAGG - Intronic
955572953 3:60327499-60327521 AACAGCCAGAGGACCAGATGTGG + Intronic
956509455 3:69978945-69978967 AAAGGCCAGAGGTCTCCATGGGG - Intergenic
957736944 3:84215230-84215252 AAATGTCAGAGTCCCCAATGGGG - Intergenic
961129339 3:124451327-124451349 AAAAGACAGAGGTTCAAAAGAGG - Intronic
961234988 3:125358238-125358260 AAAAGGCAGAGGTTGCAGTGAGG + Intronic
964314811 3:155432367-155432389 AAAGGCTAGGGGTGCCAATGGGG - Intronic
967791628 3:193555771-193555793 AACTGTCAGAAGTCCCAATGTGG + Intronic
968804964 4:2766392-2766414 AAAAGCCAGAGTTCCCACGGTGG - Intergenic
969963011 4:10965168-10965190 CAAAGCCAGAGGTGCCTCTGGGG + Intergenic
971874063 4:32281707-32281729 AAAAGATAGAGGTCCTCATGAGG + Intergenic
972805694 4:42527934-42527956 AAAGGCCAGAGGTCTCTCTGGGG - Intronic
973118250 4:46487632-46487654 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
973121207 4:46522648-46522670 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
974231800 4:59125925-59125947 AAAGGCCATAGGTCCCTTTGGGG + Intergenic
974458983 4:62163827-62163849 AAAGGCCAAAGGTCCCTTTGGGG - Intergenic
974747103 4:66090334-66090356 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
975101665 4:70521050-70521072 AAAAGCCAGAGACCCCACAGTGG - Intronic
976120927 4:81780536-81780558 AAAAGCCAAACCTCCCACTGGGG + Intronic
976986885 4:91312318-91312340 AAGAGGCAGAGATTCCAATGTGG + Intronic
980386447 4:132091903-132091925 AAAGGCCAGAGGTCTCTTTGGGG + Intergenic
980482155 4:133401005-133401027 AATAGGCAAAGGGCCCAATGTGG + Intergenic
980618834 4:135270449-135270471 TAAAGACAGAGGTATCAATGTGG + Intergenic
982527012 4:156490992-156491014 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
982835337 4:160115230-160115252 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
982847581 4:160272895-160272917 AAAGGCCAGAGGTCTTATTGGGG - Intergenic
984612050 4:181852122-181852144 AAAAGCCTGAGGATCCACTGTGG - Intergenic
986440364 5:7776258-7776280 CAAAGCCAGAGGTGCCTCTGAGG + Intronic
986742724 5:10718086-10718108 AAAAGCCAGAGGTCACCTTGGGG - Intronic
986959636 5:13197783-13197805 AAAGGCTAGAGGTCTCCATGGGG - Intergenic
987504209 5:18748449-18748471 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
987867227 5:23559923-23559945 AAAAGCCAGAGCTCTTTATGAGG + Intergenic
988107570 5:26771109-26771131 AAAGGCCAGAGGTCTCCTTGCGG - Intergenic
991028870 5:62061622-62061644 AAAAGTCAGAGGTACAAATTGGG - Intergenic
991330928 5:65491107-65491129 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
992242677 5:74788024-74788046 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
992423290 5:76628161-76628183 AAAGGCCATAGGTCCCTTTGGGG - Intronic
992748268 5:79839726-79839748 CAAAGCCAGGGGTTCCACTGTGG - Intergenic
993736467 5:91482588-91482610 AAAAGCCAGAGCTCTCACAGTGG + Intergenic
994291564 5:98033382-98033404 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
994855617 5:105114978-105115000 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
996825369 5:127676415-127676437 AAAGGCCAGAGGTCTCCCTGGGG - Intergenic
997214550 5:132099996-132100018 AAAAGCCATAGTTCCCACAGTGG + Intergenic
998290520 5:140909944-140909966 AAAAGCCGTAGGTCTCCATGGGG + Intronic
999173582 5:149616097-149616119 TAAAGCCATAGGACCAAATGAGG + Intronic
999351198 5:150873440-150873462 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
1000451767 5:161398436-161398458 AGAAGGCAGAGGACCCACTGTGG + Intronic
1001763969 5:174230444-174230466 AAAGGCCAGAGGTAGGAATGTGG - Intronic
1002000537 5:176194286-176194308 CACAGCCGGAGGTCCCAGTGTGG - Intergenic
1002253799 5:177944695-177944717 CACAGCCGGAGGTCCCAATGTGG + Intergenic
1002997773 6:2303329-2303351 AAAGGCCAGAGGTCTCCTTGAGG - Intergenic
1003325135 6:5085313-5085335 AAAAGCCGGAGGCTCCAAAGTGG + Exonic
1003696097 6:8407558-8407580 AAAAGCCAGAGGTCTCCTTGGGG + Intergenic
1005833020 6:29685970-29685992 GAAAGCCAAAGGTGACAATGGGG + Intergenic
1007394717 6:41570861-41570883 AAAAGCCAGCTCTCCCACTGAGG - Intronic
1008079547 6:47179759-47179781 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1010407144 6:75518187-75518209 AAAGGCCATAGGTCCCTTTGGGG + Intergenic
1011068904 6:83360254-83360276 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
1012001740 6:93663048-93663070 AAAAGCCAGAGGTCTCTTTGGGG - Intergenic
1012363148 6:98408040-98408062 AAAGGCCATAGGTCCCTTTGGGG + Intergenic
1013236216 6:108199372-108199394 AAAGGGCAGAGCTCCCGATGGGG + Intergenic
1013268277 6:108521424-108521446 AAAAGGCAGAGGTTGCAGTGAGG + Intronic
1013771598 6:113633946-113633968 AAAGGTCAGTGGTCCCAAAGTGG - Intergenic
1014706346 6:124752003-124752025 AAAACCCAGAGATCTCAATCTGG + Intronic
1016120095 6:140334065-140334087 AAAAGCCAGAGGTCTCCTTGGGG + Intergenic
1016511573 6:144848945-144848967 ATACCCCAGAGGCCCCAATGAGG + Intronic
1018152932 6:160956949-160956971 AGCAGCCAGAGGTTGCAATGCGG + Intergenic
1018535205 6:164811887-164811909 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1019975963 7:4581787-4581809 AAAAGCCTCAGGACCCAGTGGGG + Intergenic
1021736652 7:23645896-23645918 AAAATCCAAAGTTCCCACTGTGG + Intergenic
1023602432 7:41892923-41892945 AAAAGCCAGAAGGCCCAGTGAGG + Intergenic
1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG + Intronic
1024958449 7:54950499-54950521 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1028627060 7:92889254-92889276 AAAAGACTGAGTTCCCAGTGGGG - Intergenic
1029707155 7:102282101-102282123 CCTGGCCAGAGGTCCCAATGGGG - Intronic
1030368557 7:108672616-108672638 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1031760445 7:125707133-125707155 AAAAGCCATAGGTCCCATTGGGG - Intergenic
1032630317 7:133643939-133643961 AAAGGCCAGAGGTCTCCTTGGGG + Intronic
1032933960 7:136707480-136707502 AAAAACAAGAGATCCAAATGTGG - Intergenic
1034406791 7:150909301-150909323 AAAGTGCAGAGGTCCCATTGTGG + Intergenic
1034535449 7:151723203-151723225 AAAAGCCATAAGTCCCTTTGGGG + Intronic
1036515330 8:9438503-9438525 ACAGGCCAGAGGTCCCACTCAGG - Intergenic
1043257811 8:78157947-78157969 AAAGGCCAGAGGTCTCGTTGAGG - Intergenic
1043260165 8:78185582-78185604 AAAGGCCAGAGGTCTCATTCAGG + Intergenic
1043357988 8:79436245-79436267 AAAGGCCAGAGGTAGAAATGGGG - Intergenic
1044525557 8:93247018-93247040 TAAAGCCAGATGACCCAATTTGG - Intergenic
1045221575 8:100205269-100205291 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
1046197377 8:110882828-110882850 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1047779796 8:128101765-128101787 AAAAGCCACAGGCCTCACTGTGG + Intergenic
1049217026 8:141412965-141412987 ATCAGCCAGAGGCCCCAAAGTGG - Intronic
1049549952 8:143252621-143252643 AATGGCCCGTGGTCCCAATGGGG + Intronic
1050482478 9:6101204-6101226 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1050652904 9:7792179-7792201 AAAAGACAGAGATAGCAATGAGG - Intergenic
1057316733 9:93974012-93974034 AAAGGCCAGAGGTCTCCCTGGGG - Intergenic
1058019694 9:100074659-100074681 AAAGGCCAGAGGTCTCCTTGGGG - Intronic
1060816304 9:126637223-126637245 ATAAGCCAGAGTCCCCAAGGAGG - Intronic
1061918124 9:133767863-133767885 CAAAGCTAGAGGTCCAGATGGGG + Intronic
1062288260 9:135783271-135783293 AGAGGCCAGAGGTCCCCATCCGG + Intronic
1186469967 X:9813497-9813519 AAAGTCCAGAGGTCTCATTGGGG + Intronic
1186837741 X:13454682-13454704 AAAAGCCAAAGGCACTAATGGGG - Intergenic
1190145954 X:47891845-47891867 AAAGGCCATAGGTCCCTTTGGGG + Intronic
1191831245 X:65418891-65418913 AAAGGCCATAGGTCCCTTTGGGG - Intronic
1194179779 X:90697365-90697387 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1194210090 X:91060949-91060971 AAAGGCCAGAGGTCTCATTGGGG - Intergenic
1197002096 X:121451537-121451559 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1197044267 X:121977030-121977052 AAAGGCCAGAGGTCTCTTTGAGG - Intergenic
1197245300 X:124160725-124160747 AAAGGCCAGAGGTCTCCTTGGGG + Intronic
1199024186 X:142918300-142918322 AAAAGCCAGAGGTCTCCTTGGGG - Intergenic
1199989699 X:152979458-152979480 AAAAGCCAGAGTCCTCAAGGTGG + Intergenic
1200521105 Y:4210625-4210647 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1200526437 Y:4279534-4279556 AAAGGCCAGAGGTCTCCTTGGGG + Intergenic
1200706528 Y:6447633-6447655 GCAAGCCAGAGTTCACAATGAGG + Intergenic
1201027584 Y:9717075-9717097 GCAAGCCAGAGTTCACAATGAGG - Intergenic
1202100239 Y:21299965-21299987 AAAGGCCAGAGGTCTCCTTGGGG - Intergenic
1202180137 Y:22132779-22132801 GCAAGCCAGAGTTCACAATGAGG + Intergenic
1202211223 Y:22453620-22453642 GCAAGCCAGAGTTCACAATGAGG - Intergenic