ID: 1024247192

View in Genome Browser
Species Human (GRCh38)
Location 7:47479481-47479503
Sequence CTCCCCCACCCCCCCGTCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024247180_1024247192 0 Left 1024247180 7:47479458-47479480 CCCAAGTCCCCCCACGCCCCCTA 0: 1
1: 0
2: 5
3: 13
4: 196
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247185_1024247192 -10 Left 1024247185 7:47479468-47479490 CCCACGCCCCCTACTCCCCCACC 0: 1
1: 0
2: 7
3: 107
4: 1026
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247179_1024247192 19 Left 1024247179 7:47479439-47479461 CCAACTACAAACACAGGCTCCCA 0: 1
1: 0
2: 4
3: 22
4: 333
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247182_1024247192 -7 Left 1024247182 7:47479465-47479487 CCCCCCACGCCCCCTACTCCCCC 0: 1
1: 0
2: 6
3: 173
4: 1624
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247177_1024247192 29 Left 1024247177 7:47479429-47479451 CCTGTCAAAACCAACTACAAACA 0: 1
1: 0
2: 0
3: 26
4: 279
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247181_1024247192 -1 Left 1024247181 7:47479459-47479481 CCAAGTCCCCCCACGCCCCCTAC 0: 1
1: 0
2: 7
3: 34
4: 392
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247184_1024247192 -9 Left 1024247184 7:47479467-47479489 CCCCACGCCCCCTACTCCCCCAC 0: 1
1: 0
2: 4
3: 109
4: 1312
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data
1024247183_1024247192 -8 Left 1024247183 7:47479466-47479488 CCCCCACGCCCCCTACTCCCCCA 0: 1
1: 0
2: 7
3: 110
4: 1024
Right 1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024247192 Original CRISPR CTCCCCCACCCCCCCGTCGG CGG Intronic
No off target data available for this crispr