ID: 1024248413

View in Genome Browser
Species Human (GRCh38)
Location 7:47488268-47488290
Sequence CAGTGTCAGCACTGGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 275}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024248413_1024248418 21 Left 1024248413 7:47488268-47488290 CCTCATTCCCAGTGCTGACACTG 0: 1
1: 0
2: 7
3: 34
4: 275
Right 1024248418 7:47488312-47488334 AATAAGCAACAGTCTTAGCTCGG 0: 1
1: 0
2: 2
3: 15
4: 184
1024248413_1024248420 27 Left 1024248413 7:47488268-47488290 CCTCATTCCCAGTGCTGACACTG 0: 1
1: 0
2: 7
3: 34
4: 275
Right 1024248420 7:47488318-47488340 CAACAGTCTTAGCTCGGGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 32
1024248413_1024248419 22 Left 1024248413 7:47488268-47488290 CCTCATTCCCAGTGCTGACACTG 0: 1
1: 0
2: 7
3: 34
4: 275
Right 1024248419 7:47488313-47488335 ATAAGCAACAGTCTTAGCTCGGG 0: 1
1: 0
2: 1
3: 6
4: 121
1024248413_1024248422 29 Left 1024248413 7:47488268-47488290 CCTCATTCCCAGTGCTGACACTG 0: 1
1: 0
2: 7
3: 34
4: 275
Right 1024248422 7:47488320-47488342 ACAGTCTTAGCTCGGGTAAGGGG No data
1024248413_1024248421 28 Left 1024248413 7:47488268-47488290 CCTCATTCCCAGTGCTGACACTG 0: 1
1: 0
2: 7
3: 34
4: 275
Right 1024248421 7:47488319-47488341 AACAGTCTTAGCTCGGGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024248413 Original CRISPR CAGTGTCAGCACTGGGAATG AGG (reversed) Intronic
901622321 1:10598409-10598431 CTGTGTCCCCACTGGAAATGCGG + Intronic
905313634 1:37067504-37067526 CAGTGTCAGGACTGTGAAGGTGG - Intergenic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
907399666 1:54217098-54217120 CAGGGTCAGGACTGCGAAAGCGG + Intronic
907679238 1:56548196-56548218 CATTGACAGGACTGGGAATGGGG - Intronic
908480117 1:64531269-64531291 CATTGTCAGCACTGGAGAGGAGG - Intronic
909059123 1:70859073-70859095 CTGTGTCAGAATTGAGAATGAGG + Intronic
909907923 1:81221651-81221673 CACTGTGAGCACTGGGAACCTGG - Intergenic
910259785 1:85283974-85283996 CAGAGTCGGCACCGGGAGTGGGG - Intergenic
910326744 1:86017561-86017583 CAGAGACAGCCCTGGGACTGTGG - Intronic
912170470 1:107093316-107093338 CAGTGACAGAACAGGAAATGAGG - Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
915682497 1:157595256-157595278 CTATGTCATCAGTGGGAATGGGG + Intronic
919453912 1:197801141-197801163 CAGAGTGGGCACTGGGAGTGGGG - Intergenic
920034693 1:203058356-203058378 GAGTGTCAGCCCAGAGAATGAGG + Intronic
921616885 1:217279263-217279285 CAGTTTCATCACTGGCAATATGG + Intergenic
922323275 1:224506234-224506256 GAGTGTAAGGAATGGGAATGTGG - Intronic
922779319 1:228239457-228239479 CGGTGCTAGCACTGGGCATGTGG - Intronic
923665971 1:235999021-235999043 CCGTCTAAGCACTGGCAATGTGG - Intronic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1063879970 10:10521077-10521099 CAGGGTCAGCACTGAGCAAGAGG + Intergenic
1063923881 10:10958435-10958457 CAGAGCTAGCACAGGGAATGTGG + Intergenic
1063979050 10:11439142-11439164 CAGTTTCAGCACTGAATATGTGG - Intergenic
1064562158 10:16604352-16604374 CAGAGTCAGCACTGAAAACGGGG + Intronic
1067382509 10:45787812-45787834 CAGTGACAGAAGTGGGGATGTGG - Intronic
1068526242 10:58133604-58133626 CAGTGTAGGCAATGGGAGTGAGG + Intergenic
1069102216 10:64336013-64336035 CAGTCAGAGCACTGGTAATGAGG - Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070468620 10:76752996-76753018 CAGTGTCAGGAGTGAGAAAGGGG + Intergenic
1070948394 10:80411556-80411578 CAGTGGCTGCACTGGGACTCAGG - Intronic
1071475122 10:86019240-86019262 CATTGTCAGCGCTGGGGATGCGG - Intronic
1073461476 10:103668088-103668110 CAGTGAGATCACTGGAAATGAGG + Intronic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1077469305 11:2749367-2749389 CTCAGTCTGCACTGGGAATGGGG + Intronic
1077711243 11:4539221-4539243 AAGTGTCAGAACTGGCACTGGGG + Intergenic
1077975462 11:7243686-7243708 CATTTTCATCACTGGGGATGGGG + Intronic
1080434060 11:32223641-32223663 CTGAGTCAGTGCTGGGAATGAGG - Intergenic
1081687032 11:45049932-45049954 CAGTGTCAGCACTGAGACTGTGG + Intergenic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1083274473 11:61588823-61588845 CAGAGACAGTGCTGGGAATGGGG - Intergenic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1085201564 11:74705257-74705279 CAGTGACAGCAATAGGAGTGTGG + Intronic
1085267018 11:75243026-75243048 GAGTGCCAGCATTGGGTATGGGG - Exonic
1085549663 11:77356977-77356999 CAGTATAAGGACAGGGAATGTGG + Intronic
1086127483 11:83364179-83364201 CATTGTATGCACTGGGAATATGG + Intergenic
1087212126 11:95455278-95455300 CAGAGTTAGGACAGGGAATGGGG + Intergenic
1087301196 11:96438446-96438468 TAGTTTGAGCACTTGGAATGTGG - Intronic
1088575724 11:111269384-111269406 CACAGAAAGCACTGGGAATGTGG - Intronic
1089064725 11:115653851-115653873 CAGTGCCAGGACTTGGAATTGGG - Intergenic
1091613478 12:2031395-2031417 AAGTGGCAGCACGGTGAATGGGG + Intronic
1092211769 12:6651035-6651057 CAGCCTCAGCACCGGGAGTGGGG + Exonic
1092279826 12:7090595-7090617 CTGTCTGAGCTCTGGGAATGAGG - Intronic
1092317490 12:7433421-7433443 GAATGTCAACACCGGGAATGGGG - Exonic
1094376781 12:29798907-29798929 TAGTGTAAGCACTGGGAAAGTGG - Intergenic
1095450958 12:42329973-42329995 CTGTCTCAGCAAGGGGAATGCGG + Intronic
1096454711 12:51775433-51775455 CAGTGACAGTTCTGGGAAGGGGG - Intronic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1096984157 12:55745350-55745372 CAGAGTTAGCTCTGGTAATGGGG + Intronic
1099525755 12:83717945-83717967 CAGGTTCACCAGTGGGAATGTGG - Intergenic
1100807084 12:98296852-98296874 AACTGTCAGCACTAGGACTGTGG + Intergenic
1100807173 12:98297734-98297756 AACTGTCAGCACTAGGACTGTGG + Intergenic
1101372012 12:104138480-104138502 CCGGGTCAGCACCGGGAAGGAGG - Intergenic
1102220552 12:111191612-111191634 CAGTGGCAGGGCTGGGTATGGGG - Intronic
1102817269 12:115877182-115877204 CAGTTTCAGCATTAGGAATCAGG + Intergenic
1102952434 12:117039813-117039835 CAGTACCAGCACCAGGAATGGGG - Intronic
1103821034 12:123698931-123698953 CAGTGACAGTACTGGGAAGGAGG + Intronic
1103898349 12:124289471-124289493 CACTGAAAGCACTGGGAATCTGG + Intronic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1104727352 12:131086167-131086189 CAGTGTCTGCACTGGGCCAGAGG + Intronic
1104759047 12:131286223-131286245 CCGTCTCAGCTCTGGGATTGGGG - Intergenic
1104821562 12:131680273-131680295 CCGTCTCAGCTCTGGGATTGGGG + Intergenic
1104927782 12:132322547-132322569 GAGTGTTTGCACAGGGAATGGGG + Intronic
1108487367 13:50940579-50940601 CAGTGTGAGCACTGGCTCTGAGG + Intronic
1109348393 13:61145202-61145224 CAAAGTGGGCACTGGGAATGGGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1110533758 13:76627443-76627465 AAGGGTCAGAACTGTGAATGTGG - Intergenic
1111957756 13:94776529-94776551 CAGTGCCAACACTAGGCATGGGG + Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114590585 14:23861001-23861023 CAGTGTCAGCAATGGTGATGTGG + Intergenic
1114643157 14:24238146-24238168 CATTGTCAGGACTGAGAATATGG + Intronic
1114764753 14:25358322-25358344 CAGTGTCAGAACAGGAAAGGTGG - Intergenic
1115537215 14:34384637-34384659 CAGGGGCAGCACGGGGCATGGGG - Intronic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1118359068 14:65040788-65040810 AGGTGTCAGAACTGGGAAGGTGG + Exonic
1118753344 14:68821792-68821814 CAGTGTCAGAACAGGGTGTGTGG - Intergenic
1122005292 14:98698510-98698532 CAGCGGCCACACTGGGAATGGGG - Intergenic
1122695386 14:103549774-103549796 CTGTGAAAGCACTGGGGATGCGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123480111 15:20623243-20623265 CATTGTCAGCCTTGGGCATGAGG + Intergenic
1123637896 15:22377121-22377143 CATTGTCAGCCTTGGGCATGAGG - Intergenic
1123795104 15:23763244-23763266 CTGCGTCAGCACTGGGAACTTGG + Intergenic
1123923903 15:25090071-25090093 CTGTGTCAACACTTGGGATGGGG + Intergenic
1124441251 15:29687906-29687928 CAGGGCCAGCCCTGGGAATGGGG + Intergenic
1126528769 15:49688846-49688868 CCTTGTCAGGACAGGGAATGGGG - Intergenic
1126663977 15:51058871-51058893 CCATGTCTGCCCTGGGAATGGGG - Intronic
1127106157 15:55618610-55618632 CAGTGTCAGTGCTGTGAATGAGG - Exonic
1127912787 15:63431912-63431934 AAGTGGCAGCACTGAGACTGGGG + Intergenic
1128114634 15:65097511-65097533 CAATGGCAGCACTGGGGTTGAGG - Intronic
1128913995 15:71543317-71543339 CAGTGGCTGCACTGGGAAAGAGG + Intronic
1129051305 15:72783865-72783887 CAGTGCCAGGCCTGGGACTGAGG - Intronic
1129539355 15:76338210-76338232 CGGTGTCAGCGCTGGGCCTGCGG - Intronic
1130536689 15:84790526-84790548 CAGTATCAGCACTGGAAATGAGG + Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132183306 15:99779287-99779309 CAGTCACAGGTCTGGGAATGAGG + Intergenic
1132435128 15:101794194-101794216 CAGTCACAGGTCTGGGAATGAGG - Intergenic
1133255719 16:4514533-4514555 CACAGGCTGCACTGGGAATGGGG + Intronic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1133912041 16:10075039-10075061 CAGTGTAGGCATTGAGAATGTGG + Intronic
1134090852 16:11390986-11391008 GAGTGTCAGCACAGGGAAGGGGG - Intronic
1134429614 16:14190873-14190895 CTGTGGCAGAACTGGAAATGTGG - Intronic
1135906390 16:26515879-26515901 AACTTTCTGCACTGGGAATGTGG + Intergenic
1136031321 16:27505345-27505367 AAATGTCAGCACTGGCAAGGTGG - Intronic
1136059495 16:27716748-27716770 CATTGTCAGGACTGGGCATGGGG - Intronic
1136284512 16:29233254-29233276 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1139395412 16:66634792-66634814 AAGTGTCAGCACTGGTAAAGTGG - Intronic
1140802922 16:78505673-78505695 CATGGCCAGGACTGGGAATGAGG - Intronic
1141030290 16:80581695-80581717 ATGTGTAAGCACTGGGCATGTGG + Intergenic
1141416478 16:83879380-83879402 CTGTCTCAGCAAGGGGAATGCGG + Intergenic
1141571090 16:84934045-84934067 CAGAGTCAGCACTGGGATACCGG - Intergenic
1142044644 16:87917977-87917999 CAGTGTCGGGACTGGGACTGTGG - Intronic
1142089547 16:88202767-88202789 CTGGGTCAGCACTGGGGGTGAGG + Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1143101902 17:4509120-4509142 CAGGGTCCGCTCAGGGAATGGGG + Intronic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1144878535 17:18417626-18417648 CAGTGTCAGCTACTGGAATGAGG - Intergenic
1145147001 17:20490763-20490785 CAGTGTCAGCTACTGGAATGAGG - Intergenic
1145153699 17:20526761-20526783 CAGTGTCAGCTACTGGAATGAGG + Intergenic
1145914552 17:28563960-28563982 CAGTGTTAGGTCTGGGAAGGTGG - Intronic
1147740646 17:42669507-42669529 CAGTGTCAGCTATGGCCATGTGG - Exonic
1147846914 17:43410943-43410965 CACAGTCAGCACCGGGAATCTGG + Intergenic
1149286148 17:55166646-55166668 GAGTGCCAGCTCTGGGCATGGGG - Intergenic
1150625845 17:66840610-66840632 CAGGTTCATCACTGGAAATGTGG + Intronic
1151464039 17:74273094-74273116 GAGTGGCAGCTCGGGGAATGAGG - Intergenic
1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG + Intronic
1152047170 17:77944779-77944801 CAGTTGATGCACTGGGAATGAGG - Intergenic
1153387239 18:4511323-4511345 CAGTGGGAGAACTGGGAAGGAGG - Intergenic
1154156430 18:11947803-11947825 CATTGTCAGTCCTGGGAAGGGGG - Intergenic
1154193089 18:12246462-12246484 CATGGTCAGCACAGGGAAAGGGG + Intergenic
1156362116 18:36392242-36392264 CAGAGTAAGCACTGTGCATGGGG + Intronic
1156985410 18:43345220-43345242 CACTTTCAACACTGGGAATTAGG + Intergenic
1157504936 18:48219468-48219490 CAGTGTCCCCACCTGGAATGTGG - Intronic
1158819576 18:61144095-61144117 AATTGACAGTACTGGGAATGTGG - Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161281076 19:3446048-3446070 CAGTCTCAGCACTGCTGATGTGG - Intronic
1163290483 19:16376459-16376481 CATTGGCAGCACTGGCCATGGGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163705353 19:18809253-18809275 CATGTTCAGCTCTGGGAATGGGG - Intergenic
1164711423 19:30359627-30359649 CAATGTCGGCAGTGGGGATGAGG + Intronic
1164745795 19:30611927-30611949 CAGTGGCAGCCCTGGGAGTTAGG + Intronic
1165060956 19:33204993-33205015 CAGTGGCAGGACTGGGCATGCGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165441245 19:35829277-35829299 AAGTGTCAGCATTGGGCATTTGG + Intronic
1166759265 19:45214247-45214269 CAGTTTCAGCACTGAGGGTGGGG - Intronic
1166996174 19:46720628-46720650 CAGCGCCAGCACTGGCAATGAGG + Exonic
925814636 2:7735680-7735702 CAGGGTCTGCACTGTGACTGGGG - Intergenic
928088696 2:28361105-28361127 CTGAGTCAGCCCTGGGAAAGGGG - Intergenic
929112024 2:38413086-38413108 TGGTGTCAGAAATGGGAATGTGG + Intergenic
929997300 2:46836650-46836672 CGGTGTCAGCACTTGGGCTGGGG + Intronic
930625774 2:53696399-53696421 CAGTATCAGAATTGGGAAAGGGG + Intronic
930808385 2:55515983-55516005 CAGTATCAGTACAGGGGATGGGG + Intergenic
930977127 2:57477531-57477553 CACTGTCATCTATGGGAATGTGG - Intergenic
932142783 2:69294384-69294406 CAGAGTGAACACTGGGATTGAGG - Intergenic
933349549 2:81136551-81136573 AAGTGTTTGCACAGGGAATGGGG - Intergenic
934219080 2:90065007-90065029 CAGTGTCAGCACAGACAAAGTGG + Intergenic
935562678 2:104575121-104575143 CGATTTCAGCTCTGGGAATGAGG - Intergenic
939517988 2:143192986-143193008 CAGTGTTAGCACTTGTCATGTGG + Intronic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
942151747 2:173082638-173082660 AGGTGTCAGGACTGGGGATGAGG - Intronic
943427072 2:187750275-187750297 CAGAGTCGGCACTGGGAGTGGGG + Intergenic
945211632 2:207389307-207389329 CAGACTCAGCCCTTGGAATGGGG + Intergenic
945547666 2:211176694-211176716 CTGTTGCAGCACTGGCAATGAGG - Intergenic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
946331709 2:219013273-219013295 GCGTGTCACCAATGGGAATGGGG + Exonic
947522930 2:230862380-230862402 GAGAGTCCGCACTGGGAGTGAGG - Intergenic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
1168893863 20:1310686-1310708 CTGTGTCAGCACTGAGAAAGTGG + Intronic
1169666193 20:8038989-8039011 GATTGTCAGGACTGGGAAGGTGG - Intergenic
1170244390 20:14204581-14204603 AAGGGTCTGCAATGGGAATGTGG + Intronic
1170315021 20:15032121-15032143 CAGAGTGGGCACTGGGAGTGAGG + Intronic
1172805686 20:37610111-37610133 GATTGTCAGCACAGGTAATGAGG - Intergenic
1173050325 20:39553276-39553298 GTGTGTCAGCAATGGAAATGAGG + Intergenic
1174396860 20:50252024-50252046 GACTGTCAGCTCTGGGAAGGCGG - Intergenic
1174910339 20:54601152-54601174 CAGAGTGAGCACTGGGGCTGAGG + Intronic
1175389675 20:58619118-58619140 CAGAGGCATCACTGGGAAAGAGG + Intergenic
1175521087 20:59603504-59603526 CAGTGTGAGCGCTGGCAGTGTGG - Intronic
1175908702 20:62394461-62394483 CAGTGTCTGTACTGGGGAAGCGG - Intronic
1179030989 21:37719183-37719205 CAGAGTCATCACAGGGAATGGGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179351338 21:40614084-40614106 CAGTGCCAGGATTGGGACTGGGG - Intronic
1179824653 21:43957329-43957351 CAGGGGCCGCCCTGGGAATGTGG + Intronic
1181104473 22:20565638-20565660 CACTGTCAGCTCTGGGAGAGGGG - Intronic
1181587672 22:23862531-23862553 CTGGGCCAGAACTGGGAATGTGG - Intronic
1181939486 22:26464249-26464271 GAGGGTCTGCTCTGGGAATGGGG + Exonic
1182149416 22:28017831-28017853 CTGTGTTAGCCCTGGGGATGGGG - Intronic
1183122561 22:35741550-35741572 CAGTGTCAACACTGAGAATTGGG - Intronic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183859970 22:40662723-40662745 CAGTTGCAGCACTGGGTAGGTGG + Intergenic
1184665520 22:45986994-45987016 CAGAGTCCCCACTGGGGATGGGG + Intergenic
1185318498 22:50189557-50189579 CAGTGCCAGCACTGGGGATTTGG + Intronic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
950029174 3:9840606-9840628 CAGTGACAGCACTGAGAAAGGGG + Exonic
951969423 3:28427263-28427285 CAGTGTCTGAACTCAGAATGAGG + Intronic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953777077 3:45828794-45828816 CATTGTCAGCCCTGGGTACGTGG + Intronic
954004955 3:47583345-47583367 CAGTTTCAGAACTGGGCAGGTGG - Intergenic
954710040 3:52501107-52501129 CAGGGTCAGGACTGGGCGTGGGG + Intronic
955571264 3:60309332-60309354 AAGTGTCAGAAGTGGAAATGGGG - Intronic
956973997 3:74559146-74559168 CAGTGTCAGAACTGGGGTTTAGG - Intergenic
958819731 3:98959390-98959412 CAGTGGCAGCATGGGGAGTGGGG - Intergenic
960297473 3:115961535-115961557 CATTGGCAGCACTGGGAAGAAGG - Intronic
960442764 3:117709486-117709508 GTGTGTCAGGACTTGGAATGAGG + Intergenic
960989757 3:123302876-123302898 CAGTGTCTGCACTGGGAACAAGG - Intronic
961315523 3:126032854-126032876 CTGTGACAGCACTGAGAATATGG - Intronic
961666986 3:128498720-128498742 CAGTCGCAACTCTGGGAATGAGG + Intergenic
962258430 3:133887546-133887568 CAGTGCCAGCTCTGAGTATGAGG - Intronic
962873553 3:139518781-139518803 CATTGCAAGCACTGAGAATGGGG + Intronic
964705649 3:159616051-159616073 CAGTCTCAGTGATGGGAATGTGG + Intronic
966836910 3:184056341-184056363 TAGGGTCAGCACAGGGCATGGGG + Intronic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
969616083 4:8253268-8253290 TGGTGACAGCACTGGGCATGGGG + Intergenic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
971753468 4:30679419-30679441 CATTGTCAGCAGTGTGAAAGTGG + Intergenic
972601547 4:40577228-40577250 CAGTTTCAGTTCTGGGAAAGGGG + Intronic
973710117 4:53621525-53621547 CAGTGTCCACACTGGGTATTTGG - Intronic
978407641 4:108396872-108396894 AAGTGTCAGAACTGAGCATGGGG + Intergenic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
986744572 5:10732102-10732124 CATTGTCATCACTGAGAAAGCGG - Intronic
987001587 5:13665505-13665527 CAGTGGGAGAACTGGGAAGGAGG + Intergenic
988077284 5:26368390-26368412 GTGAGTCAGCACTGGGAAAGTGG + Intergenic
988819141 5:34863349-34863371 CAGTGTTAGCAATGAGGATGAGG + Intronic
992366735 5:76099615-76099637 GACTGACAGCACTGGGAATCAGG + Intronic
992738389 5:79746835-79746857 CAGTGTCAGGACAGGGATGGAGG - Intronic
992767735 5:80016851-80016873 TAGTGTCAGCACAGGGAGTGTGG - Intronic
994406634 5:99352993-99353015 CAGAGTAGGAACTGGGAATGGGG + Intergenic
995242208 5:109898287-109898309 TACTGTCAGGACTGGGATTGGGG - Intergenic
995632634 5:114150526-114150548 AAGGGTCAGCTCAGGGAATGTGG - Intergenic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
996368622 5:122729055-122729077 CAATGTCACCACTGAGAATGAGG - Intergenic
996380919 5:122861988-122862010 CAATGCAACCACTGGGAATGGGG - Intronic
997266612 5:132498445-132498467 CAGGGGCAGCCCTGGAAATGAGG + Intergenic
997283577 5:132663254-132663276 AAGTGTCAGCACTGCAACTGTGG + Intergenic
999968965 5:156839838-156839860 CATGTTCAGGACTGGGAATGAGG + Intergenic
1000936452 5:167307827-167307849 CAATGTTAACACTGGGACTGTGG + Intronic
1001081448 5:168670676-168670698 CAGAGCCAACACTGGAAATGTGG - Intronic
1001793526 5:174482575-174482597 TAGTGACGGTACTGGGAATGGGG - Intergenic
1004702334 6:18091049-18091071 CAGTGTGAGCAATGGCAAGGAGG - Intergenic
1005262861 6:24080329-24080351 CAATATCAGCTCTGGGAATGGGG + Intergenic
1005360888 6:25029644-25029666 TAGAGACAGCACTGGGAGTGAGG + Intronic
1006582385 6:35084416-35084438 CAGTCTCATCACTGTGAAAGGGG - Intronic
1007176528 6:39901481-39901503 CAGTGCCAGGCCTGGGACTGAGG + Intronic
1007212547 6:40206882-40206904 AAGTGTCTGCACTGGCAGTGGGG + Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1011206568 6:84905524-84905546 CAGTGTTAGCAAGGGCAATGGGG + Intergenic
1013359830 6:109383260-109383282 CAGTTTCCTCACTGGTAATGTGG - Intergenic
1015534281 6:134251594-134251616 CAGACTCATCACTGGGAACGCGG + Intronic
1015924329 6:138294218-138294240 GAGTGTAAGCAATGGGAATGTGG - Intronic
1018426427 6:163687111-163687133 CAGAGCCAGGACTGGAAATGAGG - Intergenic
1018523844 6:164685221-164685243 GAGTGGCAGCATTGGGGATGAGG - Intergenic
1018893987 6:168000688-168000710 GAGGGTCAGCAATGGGAGTGGGG - Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1018908042 6:168086561-168086583 CAGTGTCCACACTGGGCACGTGG - Intergenic
1019127803 6:169852510-169852532 ATGTGTCAGCCTTGGGAATGTGG - Intergenic
1019285831 7:222487-222509 CAGTGCCAGCCCTGGGCCTGGGG - Intronic
1020153221 7:5700074-5700096 CTGTGTCAGGGCGGGGAATGTGG - Intronic
1021522377 7:21550780-21550802 CATAGCCACCACTGGGAATGTGG - Intronic
1023371653 7:39517963-39517985 CTTAGTCAGCACTGGGAAAGAGG - Intergenic
1023494617 7:40781400-40781422 CTCTGCCAGCACTGGGAATGCGG + Intronic
1024025604 7:45407836-45407858 CAGTGTCAGCGCTGAGCACGTGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1026953626 7:74363430-74363452 CAGGGGCAGCCCTGGGAGTGGGG + Intronic
1028607505 7:92671252-92671274 CACTGTAAGCACTGAGAAGGCGG + Intronic
1030445434 7:109643109-109643131 CAGTGTCAGGAATGAGACTGGGG + Intergenic
1030571644 7:111233063-111233085 CAGTGTTTTCACTGGGAATATGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1033506972 7:142013225-142013247 AGGAGTCAGCACTGGGAATAGGG + Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1040654155 8:49485261-49485283 CTGAATCAGCACTGAGAATGTGG + Intergenic
1041190483 8:55348557-55348579 CAGTGTCAGAAGTGGACATGGGG + Intronic
1046580189 8:116082751-116082773 TAGTGTCAGACCTGGGACTGAGG + Intergenic
1047705905 8:127499408-127499430 CAGTCACAGCTGTGGGAATGAGG + Intergenic
1047985050 8:130224099-130224121 CAGGCTCAGCACTGGGAACTGGG - Intronic
1048264692 8:132975152-132975174 CAGTGCCAGCACTAGGTATTTGG + Intronic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1051687223 9:19670294-19670316 CAATATCAGCACTGGGAACTAGG - Intronic
1051910288 9:22147498-22147520 CAGTGCCACACCTGGGAATGGGG + Intergenic
1052551680 9:29958613-29958635 TACTGCCAACACTGGGAATGTGG + Intergenic
1056493935 9:87137043-87137065 AGGTGTCAGCACTTGGAAGGCGG - Intergenic
1056848452 9:90059995-90060017 CTGGGGCAGCTCTGGGAATGAGG + Intergenic
1057357348 9:94342704-94342726 CTGTGCCAGCACAGGGCATGGGG - Intergenic
1057650404 9:96914922-96914944 CTGTGCCAGCACAGGGCATGGGG + Intronic
1057767577 9:97935503-97935525 CAGTGTCAGCAGTGCCAAGGTGG + Intronic
1058843574 9:108934104-108934126 CAGCCGCAGCACTGGGAGTGCGG + Exonic
1059398613 9:114054614-114054636 CAGTGGAAGAACTGGGAAGGAGG + Exonic
1059528234 9:115013022-115013044 CACTATGAGTACTGGGAATGGGG + Intergenic
1060259870 9:122065016-122065038 GAGTGTCACCACTGGGAATTTGG - Intronic
1060588171 9:124799674-124799696 CACAGTCAGCACAGGGAATGGGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1062117391 9:134816772-134816794 AAGAGTCAGCACTGTGAGTGGGG + Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1187242875 X:17529592-17529614 TGTTGTCTGCACTGGGAATGTGG - Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1190594067 X:52035509-52035531 CAGGGACAACACTGGGAGTGGGG - Intergenic
1193871369 X:86802905-86802927 AAGTGGCAGGATTGGGAATGGGG - Intronic
1194858252 X:98961107-98961129 CAGTGTTTTCACTGTGAATGGGG + Intergenic
1198083595 X:133262729-133262751 CAGTATCAGCACTGTGAAAATGG - Intergenic
1198587767 X:138141674-138141696 CTGTGTCACCACTGGGAAAAAGG + Intergenic
1198695191 X:139328880-139328902 CAGTGACATCACTGGGTCTGAGG - Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1199512441 X:148637775-148637797 CAATCTGAGCACTGGAAATGTGG - Intronic
1199707116 X:150437300-150437322 CAGTGTCAGCGATGGCAATGTGG + Intronic
1201650150 Y:16276145-16276167 CAATGTCAACACTGGGACTTAGG - Intergenic