ID: 1024250548

View in Genome Browser
Species Human (GRCh38)
Location 7:47502726-47502748
Sequence CAGACGTAGCACCGGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024250535_1024250548 29 Left 1024250535 7:47502674-47502696 CCTCAAGCAGCCAGCTGGAGAGC 0: 1
1: 0
2: 2
3: 25
4: 258
Right 1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 122
1024250540_1024250548 19 Left 1024250540 7:47502684-47502706 CCAGCTGGAGAGCGGGGAAAGGC 0: 1
1: 0
2: 0
3: 13
4: 219
Right 1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 122
1024250534_1024250548 30 Left 1024250534 7:47502673-47502695 CCCTCAAGCAGCCAGCTGGAGAG 0: 1
1: 0
2: 2
3: 20
4: 220
Right 1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 122
1024250543_1024250548 -5 Left 1024250543 7:47502708-47502730 CCTGGCTTGGCAAGTGCCCAGAC 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG 0: 1
1: 0
2: 0
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024250548 Original CRISPR CAGACGTAGCACCGGGACAG TGG Intronic
906355919 1:45106113-45106135 CAGACGGGGCAGCCGGACAGAGG - Intronic
907140531 1:52181722-52181744 CAGACGGGGCAGCGGGGCAGAGG - Intronic
914987385 1:152472250-152472272 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
916131679 1:161616761-161616783 CAGACGTGGCGGCGGGGCAGAGG + Intronic
916320454 1:163498855-163498877 CAGACGGAGCAGCAGGGCAGAGG + Intergenic
918172440 1:182010825-182010847 CAGACGGAGCAGCGGGGCAGAGG - Intergenic
919625293 1:199904696-199904718 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
922306566 1:224350061-224350083 CAGACGGGGCATCGGGGCAGAGG + Intergenic
924765946 1:247032204-247032226 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
924824098 1:247521979-247522001 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1072684657 10:97529120-97529142 CAGACGGGGCAGCGGGGCAGAGG + Intronic
1072738647 10:97896496-97896518 CAGACAGAGCACTGGGCCAGGGG - Intronic
1075625628 10:123962744-123962766 CAGAGGCAGCACCTGGAGAGAGG - Intergenic
1082760803 11:57125079-57125101 CAGATGTAGGACAGAGACAGGGG - Intergenic
1083635746 11:64120085-64120107 CAGAAGCAGCAGCGGGGCAGGGG + Intronic
1084335922 11:68457813-68457835 CAGGTGTAGCACAGGGCCAGAGG - Intergenic
1085443384 11:76582703-76582725 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1094361756 12:29638538-29638560 CAGCCTTATCACCAGGACAGAGG - Intronic
1102268251 12:111507263-111507285 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1105921811 13:24970544-24970566 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1106683128 13:32028752-32028774 CAGAAGAGGCACCTGGACAGAGG - Intergenic
1106747562 13:32721206-32721228 CAGACGTGGCAGCCGGGCAGAGG + Intronic
1115303772 14:31913766-31913788 CAGCTGTAGCACCAGGTCAGAGG + Intergenic
1119722066 14:76898265-76898287 CAGACGAGGCAGCGGGGCAGAGG + Intergenic
1120406640 14:84099812-84099834 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1122822517 14:104354722-104354744 CAGACGCAGGTCTGGGACAGCGG + Intergenic
1123023699 14:105413752-105413774 CAGAGGTGGTGCCGGGACAGGGG + Exonic
1126125758 15:45293307-45293329 CAGACGGAGCGGCGGGGCAGAGG + Intergenic
1127824386 15:62690366-62690388 CAGACGGGGCGGCGGGACAGAGG + Intronic
1128597513 15:68964871-68964893 CAGACGGGGCAGCGGGGCAGAGG + Intronic
1129431181 15:75503275-75503297 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1132037010 15:98493163-98493185 CAGACGGGGCGGCGGGACAGAGG + Intronic
1132124674 15:99212508-99212530 ACGAAGTAGCACCGGAACAGAGG + Intronic
1132300793 15:100774315-100774337 CAGACGGGGCGGCGGGACAGAGG + Intergenic
1132540769 16:508220-508242 CAGTCACAGCACCGGGTCAGAGG - Intronic
1132548736 16:545477-545499 CAAACGTGGCCCCGGGACACGGG - Intronic
1138600068 16:58048891-58048913 CTGCCGGAGCATCGGGACAGGGG + Intergenic
1142021228 16:87783924-87783946 CAGCCAAAGCACCGGCACAGAGG + Intergenic
1142134318 16:88444637-88444659 CATACGTGGCACGTGGACAGAGG - Intergenic
1142638355 17:1271181-1271203 CAGAGGAAGCCCCCGGACAGCGG - Exonic
1142939934 17:3372180-3372202 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1143213031 17:5203544-5203566 CAGACGGAGCACCGCCAAAGGGG + Intergenic
1143535080 17:7533594-7533616 CAGACGGATCACAGGGTCAGGGG + Intergenic
1155283984 18:24270552-24270574 CAAAAGTAGCACTGGGACAGAGG + Intronic
1158646864 18:59255578-59255600 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
1163228110 19:15979262-15979284 CAGACATAGCAGGGGGACATTGG + Intergenic
1163909456 19:20176182-20176204 CAGACGGGGCAGCGGGGCAGAGG + Intronic
1164034823 19:21443836-21443858 CAGACGGGGCAGCGGGGCAGAGG + Intronic
1165093467 19:33398146-33398168 CAGAGGTAGCACCAGGCCACGGG - Intronic
1165768355 19:38364358-38364380 CAGACGGGGCAGCGGGGCAGAGG + Intronic
1168154261 19:54464389-54464411 CACAGGTATCACCGGGAAAGGGG - Intergenic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
925680741 2:6418632-6418654 CAGAAGTAGGACTGGGAAAGAGG + Intergenic
929151967 2:38756115-38756137 CAGAAGGGGCAGCGGGACAGAGG + Intronic
934606047 2:95696089-95696111 CAGACGCAGCAGCAGGACTGGGG - Intergenic
935730700 2:106062938-106062960 CAGACTTAGCAGCGGGAGAAAGG + Intergenic
936441971 2:112562361-112562383 AAGAAGTAGCAAGGGGACAGGGG - Intronic
942621075 2:177845387-177845409 CAGACGGGGCAGCGGGGCAGAGG + Intronic
946134526 2:217634886-217634908 CAGAGGGAGCACCAGGACAAAGG + Intronic
1171848526 20:30292008-30292030 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1172739109 20:37151276-37151298 CAGACGTGGCAGCCGGGCAGAGG - Intronic
1172918613 20:38461897-38461919 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1176129652 20:63491285-63491307 CAGATGCAGCACAGGCACAGCGG + Intronic
1183537259 22:38410210-38410232 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1184145454 22:42607707-42607729 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1184376788 22:44118680-44118702 CAGAGCTAGCACAGGGACAGAGG - Intronic
1203280166 22_KI270734v1_random:125861-125883 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
949394173 3:3597293-3597315 CATACTTAGCACCGGTACAGTGG + Intergenic
950741916 3:15058916-15058938 CACACACAGCACCGAGACAGAGG + Intronic
951990954 3:28675755-28675777 CAGAAGCAGCACCGAGAGAGAGG - Intergenic
952892588 3:38053389-38053411 CAGACGGAGCGGCGGGGCAGAGG - Intronic
953084926 3:39656076-39656098 CAGACGTGGCAGCCGGGCAGAGG - Intergenic
953458598 3:43063339-43063361 CAGACGCAGCAGCAGGCCAGGGG - Intergenic
957035423 3:75289385-75289407 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
960866109 3:122201775-122201797 CAGACGGGGCAGCGGGGCAGAGG + Intronic
960960413 3:123067024-123067046 CAGACGTGGCACCGGGAACTCGG + Intergenic
964062382 3:152539260-152539282 AAGACCTAGCACAGGGAAAGAGG - Intergenic
965650019 3:170923596-170923618 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
966910207 3:184555437-184555459 CAGACCTAGGACCTGGGCAGAGG + Intronic
974597941 4:64037548-64037570 CAGACGTTGCGGCGGGGCAGAGG - Intergenic
982026202 4:151255383-151255405 CAGACGGGGCAGCGGGGCAGAGG + Intronic
982075262 4:151731714-151731736 CAGACGGGGCAGCGGGGCAGAGG - Intronic
982182918 4:152765557-152765579 CAGACGGGGCGGCGGGACAGAGG + Intronic
985936433 5:3101311-3101333 CAGATGTAGAATGGGGACAGTGG + Intergenic
989634809 5:43522100-43522122 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
989648807 5:43665989-43666011 CAGACGGGGCAGCGGGGCAGAGG + Intronic
992964260 5:81983859-81983881 CAGACGGGGCAGCGGGGCAGAGG + Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
997479105 5:134169772-134169794 CAGACGTATCACAAGGTCAGGGG + Intronic
999604218 5:153297138-153297160 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1001383380 5:171318358-171318380 CAGCTGTAGCACCTGAACAGTGG - Intergenic
1001426531 5:171626094-171626116 CAGAGGCACCATCGGGACAGAGG + Intergenic
1002871565 6:1171073-1171095 CAGAAGTAGCACATGAACAGTGG - Intergenic
1006014199 6:31067408-31067430 CAGACGTGGCGGCGGGGCAGAGG + Intergenic
1008919190 6:56824605-56824627 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1009353056 6:62706993-62707015 CTAACGTAGCACAGTGACAGTGG - Intergenic
1009844725 6:69121582-69121604 CAGATGGGGCAGCGGGACAGAGG + Intronic
1009844734 6:69121619-69121641 CAGATGGGGCAGCGGGACAGAGG + Intronic
1009868891 6:69432365-69432387 CAGACGGAGCAGCTGGGCAGAGG + Intergenic
1011476149 6:87751440-87751462 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1012479423 6:99650427-99650449 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1013800079 6:113932069-113932091 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
1013810554 6:114040041-114040063 CAGACTTGCCACAGGGACAGTGG - Intergenic
1016436082 6:144039050-144039072 CAGAAGTAGCTCAGGGATAGGGG + Intronic
1016482320 6:144495380-144495402 GGGACTTAGCACCGGGCCAGCGG - Intronic
1018430177 6:163715979-163716001 CTCACGTAGCACCGTGCCAGTGG + Intergenic
1023807562 7:43884430-43884452 CACACGGAACACAGGGACAGAGG + Intronic
1024250548 7:47502726-47502748 CAGACGTAGCACCGGGACAGTGG + Intronic
1029536962 7:101162854-101162876 CCGACGCAGCCCGGGGACAGGGG + Exonic
1029690713 7:102179527-102179549 CTGAAGCAGCACCTGGACAGGGG - Intronic
1037134633 8:15446163-15446185 CAGACGGGGCATCGGGGCAGAGG + Intronic
1043756421 8:84009507-84009529 CAGACATAGCAAGGAGACAGAGG + Intergenic
1043958587 8:86390091-86390113 CAGACGGAGCGGCGGGGCAGAGG + Intronic
1045602333 8:103732367-103732389 CTGACGTAGCACAGTCACAGTGG - Intronic
1049784807 8:144445218-144445240 CAGAAGTAGCCCGGGCACAGTGG + Intergenic
1051258021 9:15233995-15234017 CAGACGGGGCAGCGGGGCAGAGG - Intronic
1056965655 9:91161253-91161275 CAGACACAGCAACAGGACAGAGG + Intergenic
1057176566 9:93004563-93004585 CAGAAGCAGCAGTGGGACAGAGG - Intronic
1057258066 9:93567065-93567087 CAGCCGTGGCCCCGGAACAGCGG - Intergenic
1057630523 9:96715876-96715898 CAGACGGGGCAGCGGGGCAGAGG + Intergenic
1058364267 9:104189012-104189034 CAGACCTAGCACCCAGGCAGTGG - Intergenic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1061495591 9:130972521-130972543 CAGACAGAGCACAGAGACAGAGG - Intergenic
1192252096 X:69421994-69422016 CAGACGGGGCAGCGGGGCAGAGG - Intergenic
1192530282 X:71877141-71877163 CAGACGGGGCGGCGGGACAGAGG + Intergenic
1192764882 X:74130128-74130150 CAGAGGTAGCATGAGGACAGGGG + Intergenic
1200527781 Y:4295597-4295619 CAGACGGGGCAGCGGGGCAGAGG - Intergenic