ID: 1024251462

View in Genome Browser
Species Human (GRCh38)
Location 7:47508802-47508824
Sequence CAGCCAGATGCCATGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 2, 2: 43, 3: 147, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251459_1024251462 7 Left 1024251459 7:47508772-47508794 CCTGGTCTCCAGGATCACTCATT 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG 0: 1
1: 2
2: 43
3: 147
4: 442
1024251461_1024251462 -1 Left 1024251461 7:47508780-47508802 CCAGGATCACTCATTCTGAGGAC 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG 0: 1
1: 2
2: 43
3: 147
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251462 Original CRISPR CAGCCAGATGCCATGTTGTG AGG Intronic
900749693 1:4387569-4387591 CAGACAGATGGCATGTGATGAGG - Intergenic
901044288 1:6386173-6386195 CAGGCACCTGCCGTGTTGTGCGG - Intronic
901830625 1:11889850-11889872 CAGCCAGGTGACAAATTGTGGGG + Intergenic
902060627 1:13639188-13639210 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
902198103 1:14813359-14813381 AACGCAGCTGCCATGTTGTGAGG + Intronic
902272102 1:15312040-15312062 AAGCCAACCGCCATGTTGTGAGG - Intronic
902661169 1:17904978-17905000 AAGCCAGGTGCCATGTCATGAGG + Intergenic
903276449 1:22224961-22224983 AAGCCAGCTGCCATGTCATGAGG + Intergenic
903785009 1:25854867-25854889 AAGCCAGCTGTCATGTTGTGAGG - Intronic
904795949 1:33056578-33056600 AAGCCAGGTGCCGTGTTGTGAGG + Intronic
905872212 1:41411478-41411500 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
906548102 1:46636839-46636861 AAGTCAGTTGCCATGTAGTGAGG + Intronic
906944026 1:50280256-50280278 CAGACAGATGGCATTTTGTTTGG + Intergenic
907400660 1:54223060-54223082 AAACCAGATGCCAGGTTCTGCGG + Intronic
907574433 1:55513387-55513409 AAGCCAGCTACCATGTTGTGAGG + Intergenic
907575470 1:55522025-55522047 AAGCCAGCTGCCATGTTGTGGGG + Intergenic
907657680 1:56360682-56360704 GACCCAGCTGCCATGCTGTGAGG - Intergenic
907950857 1:59182351-59182373 AAGCCAGCCACCATGTTGTGAGG + Intergenic
908121617 1:60991282-60991304 CAGCCAGTTTCCAGGCTGTGTGG + Intronic
908260750 1:62337882-62337904 CAGACAGAAGCCATGATGTCAGG - Intergenic
908580514 1:65511281-65511303 TAACCAGATTCCAGGTTGTGTGG - Intronic
908832184 1:68190533-68190555 AAGCCCGCTGCCATGTTGCGAGG + Intronic
910122416 1:83804966-83804988 AAGCCAGCTGCCACTTTGTGAGG - Intergenic
910682921 1:89885808-89885830 CAGCCTGAAGCCATGGTTTGAGG - Intronic
910924659 1:92386063-92386085 AAGCCACATGCCATGTTGTGAGG - Intronic
911512927 1:98829080-98829102 AAGCCAGCTGCCATGTTATGTGG + Intergenic
912211682 1:107563687-107563709 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
913083426 1:115411632-115411654 AAGCCAGGTGCCATGTTGTGAGG + Intergenic
913233521 1:116761487-116761509 AAGCTAGCTGCCATATTGTGAGG - Intronic
913681062 1:121187091-121187113 CAGCCCCACACCATGTTGTGCGG + Exonic
914032892 1:143974731-143974753 CAGCCCCACACCATGTTGTGCGG + Intergenic
914156554 1:145093235-145093257 CAGCCCCACACCATGTTGTGCGG - Exonic
914441924 1:147715277-147715299 AAGCCAGCTGCCATGTCATGAGG - Intergenic
914856543 1:151355907-151355929 AACCCAGCTACCATGTTGTGAGG + Intergenic
915006178 1:152639143-152639165 TAGCCAAATTGCATGTTGTGGGG + Intergenic
916317062 1:163460909-163460931 AAGCCAGCTGCCATGTGGTGAGG - Intergenic
916847904 1:168671974-168671996 AAGCCAGCTACTATGTTGTGAGG - Intergenic
917794681 1:178524452-178524474 AAGCCGGCTGCCATGTTGTAAGG + Intronic
918103390 1:181396144-181396166 AAGCCAGATGCTATGTCATGAGG - Intergenic
918410441 1:184253200-184253222 TATGCAGGTGCCATGTTGTGAGG + Intergenic
918533329 1:185547219-185547241 AAGCCAGATGACATGTCATGAGG - Intergenic
920324375 1:205150727-205150749 AAGCCAGAGGCCATGATGTCAGG - Exonic
920468374 1:206205615-206205637 CAGCCCCACACCATGTTGTGCGG + Intronic
920894295 1:210029337-210029359 CTGCCAAATCCAATGTTGTGAGG + Intronic
922128499 1:222753775-222753797 AAGCCATCTGCCATGTTATGAGG + Intergenic
922198774 1:223383207-223383229 GAGCCAGATGCCGTGTTATGAGG - Intergenic
922506785 1:226130934-226130956 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1063607832 10:7538584-7538606 AATCCAGCCGCCATGTTGTGAGG - Intergenic
1063622592 10:7662693-7662715 CAGCCATATGCCATTTCTTGAGG - Intronic
1063847095 10:10142218-10142240 AAGCCAGATTCCATGCTCTGTGG + Intergenic
1064366892 10:14716434-14716456 AAGCCAGCTGCCATGTCATGAGG - Intronic
1064491863 10:15866573-15866595 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1066251340 10:33636017-33636039 TAGCCAGCTGACATGTTGTCAGG + Intergenic
1066441705 10:35445584-35445606 GAGACAGAAGCCATGTTTTGAGG + Intronic
1066752575 10:38673456-38673478 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1066964457 10:42249580-42249602 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1067163671 10:43848006-43848028 AATCCAGTTGCCATGATGTGAGG - Intergenic
1067190579 10:44064549-44064571 CAGCCAGACGCCAGGCTCTGTGG + Intergenic
1068757572 10:60671757-60671779 AATCCAGCAGCCATGTTGTGAGG + Intronic
1069097661 10:64279078-64279100 AACCCAGTTGCCATGCTGTGGGG - Intergenic
1069700921 10:70425185-70425207 AAGCCAGGTGTCATGGTGTGAGG - Exonic
1069877765 10:71573732-71573754 CAGCCATAAGCCAAGCTGTGGGG - Intronic
1069959552 10:72071761-72071783 AAGGCAGCCGCCATGTTGTGAGG + Intronic
1070313481 10:75290417-75290439 AATCCAGCTGCCATGGTGTGAGG - Intergenic
1070872904 10:79773330-79773352 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1071549033 10:86551988-86552010 AAACTAGTTGCCATGTTGTGAGG + Intergenic
1071639827 10:87295481-87295503 AAGCCAGCTGCCATGCCGTGAGG - Intergenic
1071655407 10:87442471-87442493 AAGCCAGCTGCCATGCCGTGAGG + Intergenic
1071910301 10:90224186-90224208 AAGCCAGCTGCCATATTGTAGGG + Intergenic
1072176116 10:92923607-92923629 AAGCCAGCTGCCATGTCATGAGG - Intronic
1072226608 10:93375907-93375929 CCACCAGATGCCATGGTGGGAGG - Intronic
1072293614 10:93989354-93989376 AACCCAGATGCCATGTTGTAAGG - Intergenic
1072722758 10:97791049-97791071 AAGCCAGCTCCCATGTCGTGAGG - Intergenic
1073442554 10:103561131-103561153 AAGCCAGCTGCCACGGTGTGGGG - Intronic
1073475476 10:103749798-103749820 AAGCCAGCTTCCATGTTGTAAGG + Intronic
1074945603 10:118278027-118278049 TTGCCAGCTGCCATGCTGTGAGG + Intergenic
1075351374 10:121727707-121727729 AAGCCACTTGTCATGTTGTGAGG + Intergenic
1075527726 10:123200315-123200337 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1075797045 10:125128088-125128110 CACCCAGATGCCGGGTTCTGGGG + Intronic
1075941446 10:126393735-126393757 CAACCAGCTGCCATGTCGTGAGG + Intergenic
1076824122 10:132958793-132958815 CAGCCAGGTGACAGGCTGTGCGG + Intergenic
1076981991 11:209453-209475 CAGCCAGATGACACGGTGGGAGG - Exonic
1077085570 11:748142-748164 CAGCGAGATGCAATTTTGTTGGG + Intronic
1077268001 11:1661466-1661488 CAGCCAGATGCCACGGGATGTGG - Intergenic
1077272918 11:1690266-1690288 CAGCCAGATGCCACGGGATGTGG + Intergenic
1077354338 11:2108241-2108263 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1077417792 11:2432893-2432915 CAGCCCGAAGCCATGCAGTGGGG + Intergenic
1078368475 11:10725716-10725738 AAGCCGGCTGCCATGTTGTGAGG - Intergenic
1078828651 11:14956350-14956372 AAGCCAGATGCCATGTCAAGAGG - Intronic
1079960769 11:26920431-26920453 AAATCAGATGCCATATTGTGAGG - Intergenic
1083493503 11:63030578-63030600 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1083730266 11:64648955-64648977 CAGCCAGATGCCATTGTCTTGGG - Intronic
1084199550 11:67546433-67546455 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1084487392 11:69456874-69456896 CACCCAGCTGCCATATTGTAAGG + Intergenic
1085536632 11:77224495-77224517 AAGTAAGCTGCCATGTTGTGAGG + Intronic
1085729872 11:78988173-78988195 AAACCAGCTGCCATGTTGTGAGG + Intronic
1086858014 11:91890133-91890155 AAAGCAGCTGCCATGTTGTGAGG + Intergenic
1086980676 11:93195056-93195078 AAGCCAGCTGTCATGTTGTGAGG - Intronic
1087024003 11:93631981-93632003 CAGACAGATGCAGTGTGGTGAGG - Intergenic
1087427138 11:98004083-98004105 CAGCTTCCTGCCATGTTGTGGGG + Intergenic
1087611497 11:100439399-100439421 AAGCCAGCTGCTGTGTTGTGAGG - Intergenic
1088447326 11:109946160-109946182 CACCCAGATGCAAAATTGTGAGG - Intergenic
1088568653 11:111199401-111199423 AAGCCAGCTGCCCTGTTATGAGG + Intergenic
1088812944 11:113403778-113403800 CAGGCAGTTGCCATGTTGCGTGG + Intergenic
1090019614 11:123116062-123116084 AAGCCAGCTGCCGTGTGGTGAGG - Intronic
1090040595 11:123287594-123287616 CAGCCATCTGCCATGTCATGAGG - Intergenic
1090964529 11:131586447-131586469 GAGCCAGCTGCCATGTTGTGAGG + Intronic
1090964695 11:131588259-131588281 TGGCCAGCTGCCATGTTGTGAGG - Intronic
1091501308 12:1020696-1020718 AATCCAGCTGCCATGTCGTGAGG - Intronic
1092251018 12:6896970-6896992 AAGCCAGCTGCCATGTTATGAGG + Intronic
1092274326 12:7047892-7047914 AACCCAGATGCCATGCTGTGGGG - Intronic
1092911731 12:13151663-13151685 AAGCCAGCGGCCATCTTGTGAGG - Intergenic
1093167239 12:15818077-15818099 AACCCAACTGCCATGTTGTGAGG - Intronic
1093511670 12:19936473-19936495 TAGCCAGCTGCCATGTTGTGAGG + Intergenic
1093746706 12:22750521-22750543 AAGTCAGAAACCATGTTGTGAGG + Intergenic
1094048168 12:26190319-26190341 AAGCCAGCCACCATGTTGTGAGG + Intronic
1094726192 12:33119061-33119083 GATCCAGAGGTCATGTTGTGTGG + Intergenic
1095577051 12:43752299-43752321 AAGCCAGCTGCTATGCTGTGAGG - Intronic
1096214266 12:49791021-49791043 CAGCCAGTTGCCCTGGTGAGGGG + Intergenic
1096511639 12:52133166-52133188 CAGCCAGCTGCCATATCATGAGG + Intergenic
1097959307 12:65516991-65517013 AAGCCAGCTGCCATGCTGTAAGG + Intergenic
1097970432 12:65627493-65627515 AAGCCAGCTGCCATGTTATAAGG - Intergenic
1099084455 12:78227890-78227912 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
1099407088 12:82277737-82277759 CAGCAAAATGACTTGTTGTGGGG - Intronic
1099408969 12:82300828-82300850 AAGCCAGATGCCGTTTTGTAAGG - Intronic
1099429248 12:82561904-82561926 CAGCCATATGACATGTTGAGTGG + Intergenic
1100200270 12:92290662-92290684 AAGCCAGCTGTCATGTTTTGAGG + Intergenic
1100218912 12:92482731-92482753 AAGACAGCTGCCATGTTGAGAGG + Intergenic
1100517384 12:95341590-95341612 CAAACAGATGCCACGTTGTGGGG + Intergenic
1101864327 12:108508939-108508961 AAGCCAGCTGCCATGTTGAGAGG + Intergenic
1102165128 12:110799993-110800015 AATCCAGCTGCCATGTTGTGAGG + Intergenic
1102398092 12:112604865-112604887 TGGCCAGCTGCCATGTTGGGAGG - Intronic
1102426019 12:112845012-112845034 TGGCCAGCCGCCATGTTGTGAGG - Intronic
1102710087 12:114918224-114918246 AAACCAGCTGCCATGTGGTGAGG + Intergenic
1102774010 12:115503065-115503087 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1102775767 12:115517533-115517555 AAGCCTGCTGCCATATTGTGAGG + Intergenic
1102786618 12:115610331-115610353 AAGCCAGATGCCATATTTTGAGG - Intergenic
1102881500 12:116488492-116488514 AAGCCAGCTGCCATGTTGTAAGG - Intergenic
1103202342 12:119098101-119098123 AAGCCAGCCGCCATGTTGTGAGG + Intronic
1103248277 12:119477157-119477179 CATTCAGCTGCCATGCTGTGGGG - Intronic
1104079297 12:125416208-125416230 CTGCCAGATGTCCTGATGTGAGG - Intronic
1104428571 12:128697784-128697806 TAGCCAGGGGCTATGTTGTGTGG - Intronic
1104608629 12:130208804-130208826 GAATCAGCTGCCATGTTGTGAGG + Intergenic
1105607762 13:21941454-21941476 CAGGTAGTAGCCATGTTGTGAGG - Intergenic
1105627744 13:22129632-22129654 AACCCAGCTGCCATGTTGTGAGG - Intergenic
1105753727 13:23445708-23445730 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1106340722 13:28824068-28824090 CTGCTAGATGCCATGTTATATGG - Intronic
1107306459 13:39025516-39025538 AAGCCAGCTGCCATGTCATGAGG + Intronic
1108966848 13:56317982-56318004 AAGCCAGTTGCAGTGTTGTGAGG + Intergenic
1109110526 13:58313382-58313404 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1109795403 13:67305657-67305679 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1111593717 13:90384000-90384022 AAGCCAGCTGTCATTTTGTGAGG - Intergenic
1111692146 13:91578053-91578075 AAGCCAGCTGCCATGTTGTAAGG + Intronic
1113899633 13:113788958-113788980 GACCCACATGCCATGCTGTGGGG + Intronic
1114457007 14:22862007-22862029 AAGCCAGCTGCCATGTTATGAGG + Intergenic
1114595680 14:23909732-23909754 AAGCCAGCTACCATGTTGTGAGG - Intergenic
1115606237 14:35005188-35005210 CAGGCATATGCCATGATGTCTGG - Intronic
1116557929 14:46336958-46336980 GAGCCAGTTGTCATGTTTTGAGG + Intergenic
1117049885 14:51849255-51849277 AAACCAGGTGCCATGTTGTGAGG - Intronic
1117802184 14:59455722-59455744 AACCCAACTGCCATGTTGTGAGG - Intronic
1118169306 14:63370900-63370922 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1118243541 14:64084992-64085014 AAGCCAGCTGCCATGGTGTGAGG - Intronic
1118305596 14:64652412-64652434 AAGTCAGCTGCCATGTTGTGAGG - Intergenic
1119551517 14:75517392-75517414 GAGCCAGTTGCCATGTCATGGGG + Intergenic
1119890313 14:78177503-78177525 TAGCCAGACGCCCTGGTGTGGGG + Intergenic
1121434334 14:93909139-93909161 AAGCCAGCTGCCATGTTGTGGGG - Intergenic
1121656929 14:95604070-95604092 CAGAAAGCTGCCATGTCGTGAGG + Intergenic
1122777981 14:104131244-104131266 CAGCCAGATCCCGTGTTGGAGGG + Intergenic
1122985213 14:105208738-105208760 CAGCCAGGTGGCATGGAGTGGGG - Intergenic
1124495676 15:30185522-30185544 CACCCAGGTGCCATGTGCTGGGG + Intergenic
1124627032 15:31313865-31313887 AAGCCAGCTGCCATGTTATGAGG + Intergenic
1124747897 15:32353124-32353146 CACCCAGGTGCCATGTGCTGGGG - Intergenic
1125066123 15:35487555-35487577 ATGCAGGATGCCATGTTGTGAGG + Intronic
1125294982 15:38192704-38192726 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1125445741 15:39754109-39754131 AAGTCAGCTACCATGTTGTGAGG + Intronic
1125693707 15:41617727-41617749 AAGCTAGCTGCCATGTTGTAAGG + Intergenic
1126116558 15:45213116-45213138 AAGCCAGATGCCATGATGTGAGG + Intergenic
1126357334 15:47810607-47810629 CAGCCAGTTGCCATGGCATGTGG - Intergenic
1126380236 15:48038970-48038992 GACCCAGCTGCCATGTTGTGAGG - Intergenic
1127325612 15:57892167-57892189 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1127434992 15:58948678-58948700 AATCCATCTGCCATGTTGTGAGG + Intronic
1127467808 15:59261449-59261471 CAAGCAGATGCCATATTTTGGGG - Exonic
1127582886 15:60353780-60353802 AAGCCGGCTGCCATGTTGTGAGG + Intronic
1127787990 15:62373036-62373058 AAACCAGCTGCCATGTTGTGAGG + Intergenic
1128244395 15:66123334-66123356 AAGCCAGATGCCCTGATATGGGG + Intronic
1128474612 15:67986569-67986591 TAGTCAGATGCCATATTGTGTGG + Intergenic
1129382095 15:75174396-75174418 CAGCAATATGCCATGTTCAGTGG + Intergenic
1129766405 15:78171995-78172017 AAGCCGGCTGCCATGTTGTGAGG + Intronic
1130150706 15:81309385-81309407 AATCCAGACACCATGTTGTGAGG - Exonic
1130271680 15:82454134-82454156 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130464028 15:84181521-84181543 AAGCCAGTTGCCATGTGATGAGG - Intronic
1130474829 15:84255451-84255473 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130482245 15:84369507-84369529 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130488656 15:84413312-84413334 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130500239 15:84492020-84492042 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130507794 15:84562499-84562521 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130586324 15:85186153-85186175 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130978957 15:88799511-88799533 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1131194667 15:90346014-90346036 AAGCCAGCTGACACGTTGTGAGG + Intergenic
1131452864 15:92560756-92560778 AACCCAGATGCCATGCTGTGAGG + Intergenic
1131563828 15:93467623-93467645 AAGCCACCTGCCATGTTGTGAGG - Intergenic
1132156543 15:99499764-99499786 AAGCTGGCTGCCATGTTGTGAGG + Intergenic
1132388639 15:101421559-101421581 AAGCCAGCTACCATGTTATGGGG + Intronic
1132428126 15:101737812-101737834 AAGCCAGTTGCCATGTGATGAGG + Intronic
1133455560 16:5939516-5939538 CGGCCAGCAGCCATGTTGTGAGG - Intergenic
1134064164 16:11216441-11216463 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1134157506 16:11855573-11855595 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1134572162 16:15300412-15300434 AAGCCAGCTGCCATGTTTTGAGG - Intergenic
1134730219 16:16455636-16455658 AAGCCAGCTGCCATGTTTTGAGG + Intergenic
1134789158 16:16972895-16972917 AAGCCAGATTCCATGTCATGAGG + Intergenic
1134937212 16:18256263-18256285 AAGCCAGCTGCCATGTTTTGAGG - Intergenic
1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1136104583 16:28020757-28020779 AAGCCAGCTGCCATGTTGTGAGG + Intronic
1136384351 16:29913765-29913787 AAGCCAGTTGCCATGCTGCGAGG - Intronic
1136730148 16:32403575-32403597 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1138093068 16:54192447-54192469 CAGCTGGCTGCCATGTTGTAAGG + Intergenic
1139271683 16:65689676-65689698 AAGCCAGCTGCCATGTTGTAAGG - Intergenic
1140831632 16:78756943-78756965 AAGCCAGCTGCCATGTTGGGAGG + Intronic
1141373288 16:83506744-83506766 AAGCCAAATGCCGTGTTGTAGGG + Intronic
1141816430 16:86412869-86412891 AATCCAGCTGCCATGTTGTGAGG + Intergenic
1142285834 16:89171240-89171262 GAGCCAGAGGCCAGGCTGTGGGG - Intergenic
1202996253 16_KI270728v1_random:113733-113755 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1203022940 16_KI270728v1_random:426075-426097 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1142514806 17:420689-420711 AAGCCAGCTGCAGTGTTGTGTGG + Intronic
1142620491 17:1162523-1162545 GAGGCAGAGGCCATGTGGTGAGG - Intronic
1142727313 17:1825452-1825474 CAGGCACATGTCATGTTGTCTGG + Intronic
1143978975 17:10851551-10851573 AAGCAAGCTGCCACGTTGTGAGG - Intergenic
1144580836 17:16458380-16458402 AAGCCAGCTGCCATGATGTGAGG + Intronic
1144657591 17:17047228-17047250 CAGGCAGCTGGCATGATGTGTGG + Intronic
1144717415 17:17444160-17444182 CAGCCAACTGCCATGTTGTAAGG + Intergenic
1144736009 17:17555819-17555841 CACCCAGATGCCATATTCAGAGG - Intronic
1146138717 17:30345993-30346015 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
1146186527 17:30727925-30727947 CCACCCGATGCCAAGTTGTGTGG - Intergenic
1146508773 17:33427945-33427967 AAGCCAGCAGCCATGTTGTCAGG + Intronic
1146686233 17:34843326-34843348 AAGCCAGCCGCCATGTTGTGAGG + Intergenic
1146687622 17:34852213-34852235 CAGTCAGCACCCATGTTGTGTGG - Intergenic
1147017333 17:37502763-37502785 AACCCAGCTGCCATGCTGTGAGG - Intronic
1148191149 17:45679520-45679542 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1148681206 17:49474596-49474618 AAGCCAGCTGCTATGTTGTAAGG + Intronic
1149238845 17:54624836-54624858 AAGCCAGTCGTCATGTTGTGAGG + Intergenic
1149487037 17:57050555-57050577 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1149511607 17:57246716-57246738 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1149696182 17:58617955-58617977 CTGCCAGCTGCCATGATATGAGG + Intronic
1150431239 17:65119155-65119177 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
1150458660 17:65328768-65328790 AAGCCAGTTGCCATGGTGTGAGG + Intergenic
1151170782 17:72244191-72244213 TACCCAGCTGCCATGTTGTAAGG + Intergenic
1151432673 17:74074723-74074745 AACCCAGCTGCCATGTTGTGAGG + Intergenic
1151647333 17:75442176-75442198 AAGCCAGAAGCCATGTCCTGAGG + Intronic
1151903251 17:77031642-77031664 CAGCCAGCAGCCATGCTGTGAGG + Intergenic
1151968952 17:77447454-77447476 CAGCCAGATCCCATGGCCTGTGG + Intronic
1152016589 17:77755070-77755092 AAGTCGGCTGCCATGTTGTGAGG + Intergenic
1152989063 18:345963-345985 CAGCCAGCTGCCACATTGTGAGG + Intronic
1153337556 18:3940113-3940135 AAGCCAGCAGCCATGTTGTAAGG + Intronic
1153562452 18:6384792-6384814 AAGCCAGCTGCCATGTTATGAGG + Intronic
1153662115 18:7334065-7334087 CAGACAGGTGACATATTGTGAGG - Intergenic
1154120705 18:11650078-11650100 AAACCAGCTGCCATGCTGTGAGG + Intergenic
1155013752 18:21810804-21810826 CTGCCAGATACAATGCTGTGAGG - Intronic
1158715141 18:59872146-59872168 CAGCCAGGTGCAGTGATGTGTGG - Intergenic
1158895665 18:61910390-61910412 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1158985831 18:62815583-62815605 AAGCCAGCTGCCCTGTCGTGAGG - Intronic
1159758734 18:72398312-72398334 AAGTCAGCTGCCCTGTTGTGAGG + Intergenic
1160044673 18:75375719-75375741 AAGCCAGATGTCAGGTTGGGTGG + Intergenic
1160418452 18:78727952-78727974 CAGCCAGGGGCCTTGGTGTGGGG - Intergenic
1161005350 19:1932968-1932990 AACCCAGCTGCCATCTTGTGAGG - Intergenic
1161025723 19:2035859-2035881 AACACAGCTGCCATGTTGTGAGG + Intergenic
1161143169 19:2660854-2660876 AAGCCAGCTGCCATGTTGTGGGG + Intronic
1161188859 19:2941867-2941889 CAGCCCCATGCCATATTGTGAGG - Intronic
1161205926 19:3041485-3041507 CAGCAAGAGCCCATGTTGGGAGG - Intronic
1161291727 19:3497361-3497383 AAGCCAGTGACCATGTTGTGAGG + Intronic
1161434808 19:4256811-4256833 TACGCAGCTGCCATGTTGTGAGG - Intronic
1161514830 19:4690502-4690524 CGTCCAGCTGCCTTGTTGTGGGG - Intronic
1161872293 19:6879468-6879490 TAGCCAGTCGCCATGTTGTAAGG - Intergenic
1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG + Intronic
1163145634 19:15377874-15377896 CAGACAGATGCCATAGTGGGCGG - Intronic
1163256298 19:16157873-16157895 CCCCCGGATGCCATGGTGTGGGG - Exonic
1163578179 19:18122781-18122803 CAGGCAGATGCCGGGTTGTGGGG + Intronic
1164870933 19:31642137-31642159 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1165482851 19:36075458-36075480 CAGCCAGATTCCGTCTTGGGGGG - Intronic
1166032080 19:40139206-40139228 CAGCCACATGCCATGGTGCCCGG - Intergenic
1166549879 19:43658182-43658204 CAAGCAGCAGCCATGTTGTGAGG + Intronic
1166934961 19:46326254-46326276 AAGCCAACTGCCATGTTGTGAGG - Intronic
1167120024 19:47511302-47511324 CAGCCAGAGGCCAGCTTGGGAGG - Intronic
1167170367 19:47827004-47827026 AAGCCAGCCGCCATGTTGTGAGG - Intronic
1167274614 19:48529270-48529292 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1167673297 19:50868864-50868886 CACCCTGTAGCCATGTTGTGAGG - Intronic
1168555908 19:57339670-57339692 CAGCAGGATGCCATGTTGTTGGG - Intergenic
1168676314 19:58280352-58280374 AAGCCAGATGCCATGTTGCAAGG - Exonic
927055208 2:19360432-19360454 CAGCCAGAGGCCCTATCGTGTGG - Intergenic
927195838 2:20546148-20546170 AAGCCAGTGGCCATGTTGTGAGG + Intergenic
928236363 2:29545039-29545061 CAGTCAGATGCCCTGTGGTTTGG + Intronic
928279369 2:29930577-29930599 AAGCCAGTTGCCATGTTGTAAGG + Intergenic
928399618 2:30968474-30968496 AAGCCAGCTGCCATGCTGTGGGG + Intronic
929027470 2:37618416-37618438 ATCCCAGCTGCCATGTTGTGAGG - Intergenic
929050974 2:37836621-37836643 CAGCCAGATGTCATCTTGGTTGG - Intergenic
929929505 2:46241468-46241490 AAGCCAACTACCATGTTGTGAGG - Intergenic
931130997 2:59335683-59335705 AAGCCAGCTGCCATGTCATGAGG + Intergenic
931318159 2:61151675-61151697 AAGCCAGTTGCCATGTTGTAAGG - Intronic
931384644 2:61787185-61787207 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
932872560 2:75417165-75417187 CAGCCAGAGGCTATGATGTCAGG - Intergenic
933254694 2:80067764-80067786 CAGCCAGATGCCATGTTTGAAGG + Intronic
933504620 2:83161601-83161623 CAGTCAGAGGCAATGCTGTGTGG + Intergenic
934186454 2:89681628-89681650 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
934315563 2:91915602-91915624 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
935420076 2:102858163-102858185 AAACCTGCTGCCATGTTGTGAGG - Intergenic
935550932 2:104453314-104453336 CAGCCAGGTGCCATGTTGCAGGG + Intergenic
935813595 2:106825265-106825287 AAGCCAGCTGCCATGTTGTGAGG + Intronic
936389995 2:112063285-112063307 AAGCCAGCTGCCATGTCGTGAGG + Intronic
936429773 2:112452218-112452240 AAGCCAGTTGCTATGTTGTGAGG - Intergenic
936503686 2:113087171-113087193 AACCCAGTTGCCATATTGTGGGG - Intergenic
938018657 2:127887783-127887805 CTTCCAGATGCCATGTTTTAAGG - Intergenic
938694035 2:133819246-133819268 CTACCTGCTGCCATGTTGTGAGG - Intergenic
938723441 2:134086258-134086280 AACCCAGCAGCCATGTTGTGAGG + Intergenic
938813649 2:134877603-134877625 CATCCAGCAGCCATGTTGTGAGG - Intronic
939282057 2:140076353-140076375 CAGCCAGCAGTCATGTTGTTTGG + Intergenic
939334629 2:140809850-140809872 AAGCCAGCTGACATGTTATGAGG - Intronic
939604563 2:144237868-144237890 CTGCCAGCTGCCACGTTGTGAGG + Intronic
939784923 2:146497505-146497527 CAGTAAGATGTCATGTTGTGAGG - Intergenic
940645574 2:156389075-156389097 CAGCCAGAAGCCTTTTTTTGGGG + Intergenic
940736931 2:157464017-157464039 GAGCAAGATTCCATTTTGTGGGG + Intronic
942212103 2:173681506-173681528 AATCCAGACACCATGTTGTGAGG - Intergenic
942252093 2:174055759-174055781 AAGCCAGATGCCATGTTATGAGG + Intergenic
942642779 2:178077000-178077022 AACCCAGATGCCATATTGTAAGG - Intronic
942655635 2:178211562-178211584 CAGCCAGATGCCATTTTGATAGG + Intronic
942847357 2:180442735-180442757 AAGCCAATTGCCATGTTGTGAGG + Intergenic
942907571 2:181202319-181202341 AAGCCAGCTGCCCTGTTGTGAGG + Intergenic
943281875 2:185945326-185945348 AAGCCAGCTACCATGTTGTGAGG + Intergenic
943333096 2:186584199-186584221 AAGCCAGCTGCCATGTTATGAGG - Intergenic
943602358 2:189937341-189937363 AAGCCAGCTGACATGTTGTGAGG + Intronic
943724923 2:191243819-191243841 AACCCAGCTGCCATATTGTGAGG - Intergenic
945710319 2:213286872-213286894 CAGCCAGGATCCATCTTGTGGGG + Intronic
946481735 2:220063459-220063481 CTCCCAGTTGCCATGGTGTGAGG + Intergenic
946961987 2:224995109-224995131 AAGCCAGCTGCCATGTCATGAGG - Intronic
947613988 2:231542943-231542965 AACCAAGCTGCCATGTTGTGAGG + Intergenic
947773487 2:232689378-232689400 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
947821774 2:233076859-233076881 CAGCCAGTTGGCAGGGTGTGGGG + Intronic
947997310 2:234539231-234539253 TAGGCAGCTGCCATATTGTGAGG + Intergenic
948290655 2:236821880-236821902 AAGCCAGCCGCCATGTTGTGAGG + Intergenic
1168769190 20:403692-403714 CAGCCAGCTGCCATGTTGCGAGG + Intergenic
1168828014 20:827041-827063 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1169034575 20:2439014-2439036 AACCCAGCTACCATGTTGTGAGG - Intergenic
1169058614 20:2643826-2643848 AAACCAGCAGCCATGTTGTGAGG - Intergenic
1169315307 20:4585494-4585516 AAGCCAGCTGCCATGTCGTAAGG - Intergenic
1169410150 20:5361930-5361952 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1169499579 20:6146403-6146425 AAACCGGAAGCCATGTTGTGAGG - Intergenic
1169504642 20:6196074-6196096 GAGCCAGCTGCCATGTCATGAGG + Intergenic
1169836919 20:9890633-9890655 GAGCCAGCTACCATGTTGTGAGG + Intergenic
1169892792 20:10471904-10471926 AAGCTAGATGCCATGTTGTAAGG - Intronic
1170050703 20:12141690-12141712 ACTCCAGATGCCATGTTGTGAGG - Intergenic
1170284847 20:14695587-14695609 AAACCAGCTACCATGTTGTGAGG + Intronic
1170417886 20:16163992-16164014 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1170511650 20:17083765-17083787 CAGCCAGAGACCAGATTGTGAGG - Intergenic
1170607994 20:17888067-17888089 GAGTCAGCTGCCATGTTGTGAGG + Intergenic
1171040619 20:21759103-21759125 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1171311517 20:24148886-24148908 AACCCAGCTGCCATGCTGTGAGG - Intergenic
1171365540 20:24620507-24620529 AAGCCAGCTGCCGTGTTGTGAGG - Intronic
1171388805 20:24787723-24787745 CAGCCATGTGCCCTGGTGTGAGG - Intergenic
1172179219 20:32990600-32990622 AGGCCAGCTGCCATGTTGAGAGG + Intronic
1172219267 20:33261635-33261657 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1172315205 20:33948674-33948696 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1172356262 20:34282235-34282257 AAGCCAGATGCCATCTCCTGAGG + Intronic
1172892050 20:38272503-38272525 AAGCCAGCTGCCATTTTGTTAGG + Intronic
1172946834 20:38696069-38696091 AAGCCAGTCACCATGTTGTGAGG - Intergenic
1173012501 20:39195051-39195073 CAGCCAAATGCAATGATTTGGGG - Intergenic
1173186713 20:40845893-40845915 AAGTCAGCTGCCATATTGTGAGG - Intergenic
1173458003 20:43219255-43219277 GTACCAGTTGCCATGTTGTGAGG + Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174678976 20:52386187-52386209 AAGCCAGGTACCATGTTATGTGG - Intergenic
1175154724 20:56962780-56962802 AAGCCAGCTGCCATGTTGTAAGG + Intergenic
1175157785 20:56983958-56983980 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
1176101936 20:63368379-63368401 CAGCCAGAGGGCAGGGTGTGAGG - Intronic
1177318205 21:19488693-19488715 CTGCCAGACACCATGTAGTGGGG - Intergenic
1177426837 21:20934382-20934404 CAGACACATGCCATGTAGGGGGG - Intergenic
1177808476 21:25899504-25899526 GTGCGAGATGCCATGTTGTAGGG + Intronic
1178322898 21:31619255-31619277 AAGCCAGCTGCCATGTTGCAAGG + Intergenic
1178425756 21:32477630-32477652 AAGCCAGCTGCCGTGTTGTAAGG - Intronic
1178475810 21:32936045-32936067 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1178682195 21:34681662-34681684 AAGCCAGATGCCATGTTGTGGGG - Intronic
1179717248 21:43295761-43295783 AATCCAGCCGCCATGTTGTGAGG - Intergenic
1180542333 22:16461487-16461509 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1180915519 22:19483525-19483547 CAGACAGAGGCCAAGTTGTGGGG + Intronic
1181768441 22:25109010-25109032 AAGCCAGCCGCCATGTTGTGAGG - Intronic
1181821360 22:25478205-25478227 AAGCCAGCTGCCATGTCGTGGGG + Intergenic
1182021856 22:27088359-27088381 AAACCAACTGCCATGTTGTGAGG - Intergenic
1182039237 22:27223606-27223628 AAGCCAGATGCCATGTCATGAGG - Intergenic
1182061706 22:27403076-27403098 AACCCAGCTGCCATGTTGTGAGG + Intergenic
1182087642 22:27572449-27572471 AAGCCAGCTGCCATTTTGTGAGG + Intergenic
1182469349 22:30538454-30538476 AAGCCAACTGCCATGTTGTGAGG + Intronic
1182497544 22:30720466-30720488 AAGCCAGCTGTCATGTTGTGAGG - Intronic
1182542675 22:31053169-31053191 AAGCCTGCTGCCATGTTGTGAGG - Intergenic
1182729149 22:32473813-32473835 AAGCCAGCTGCCATGTCATGGGG + Intergenic
1183395750 22:37569757-37569779 CACCCGGCTGCCATGTTGGGAGG - Intergenic
1183680774 22:39328010-39328032 CAGCCAGCTCCCATTCTGTGGGG - Intergenic
1184183658 22:42848996-42849018 AAGCCAGGTGCCATGTCTTGAGG + Intronic
1184388735 22:44190920-44190942 CAGCCAGATGCCCTCTGCTGAGG - Intronic
1184420353 22:44378546-44378568 AATCCAGCAGCCATGTTGTGAGG + Intergenic
1184427253 22:44418329-44418351 CAGTGATATGCCATGTTGGGAGG - Intergenic
1184620872 22:45675523-45675545 AAGCCAGCTGCCATGTCATGAGG + Intronic
1185290067 22:50019543-50019565 AAGCCAGCTGCCATGTTGTGAGG + Intronic
949168677 3:971849-971871 CAGTGAGATGCCATGTTGTGAGG + Intergenic
949524379 3:4888821-4888843 AAGCCAGCTGCCATGTTACGAGG + Intergenic
949652945 3:6181967-6181989 AACCCAGTTGCCATGCTGTGAGG - Intergenic
950120501 3:10479332-10479354 CAGACAAAGGCCATGTGGTGGGG - Intronic
950213577 3:11141622-11141644 AAGCCAGCTGCCATGTTGTGAGG - Intronic
950291375 3:11787116-11787138 AACCCAGCCGCCATGTTGTGAGG - Intergenic
950899803 3:16487228-16487250 GGGCCAGATGCCATGTCTTGGGG - Intronic
950901542 3:16502627-16502649 AAGCCAGCTGCCATGTTGTGAGG + Intronic
951086753 3:18520811-18520833 CAGCAGAATGCAATGTTGTGGGG - Intergenic
951111856 3:18813158-18813180 AATCTAGTTGCCATGTTGTGTGG + Intergenic
951243346 3:20312521-20312543 CAGCCAGCTGCCATGTTATGAGG - Intergenic
951470481 3:23051185-23051207 AAGCCAGCTGCCATGCTGTGAGG + Intergenic
951732283 3:25823653-25823675 CAGGCAGGTGCCATGTTCTAGGG + Intergenic
951952275 3:28213431-28213453 AAACCAGTTGCCATGATGTGAGG - Intergenic
952102996 3:30036440-30036462 AAGCCAGCTGCCATGTTCTGAGG - Intergenic
952792544 3:37211720-37211742 AAACCAGCTGCCATATTGTGAGG - Intergenic
952865241 3:37850853-37850875 CAACCAGCCACCATGTTGTGAGG + Intergenic
953004680 3:38967363-38967385 AAGCTAGTTGCCATGCTGTGAGG + Intergenic
953499473 3:43419138-43419160 AAGCTAGCTGCCATGTTGTGAGG - Intronic
953985522 3:47439541-47439563 CACCCAGATGCCATGTTAGTTGG - Intronic
954626080 3:52022605-52022627 CAGGCAGGTCCCAGGTTGTGGGG - Intergenic
955067168 3:55543573-55543595 CATGCAGATGACATGGTGTGTGG + Intronic
955686903 3:61558345-61558367 GAGTAAGCTGCCATGTTGTGAGG + Intergenic
955698712 3:61662305-61662327 AAGCCACCTGCCATGTTGTGAGG + Intronic
955931150 3:64058115-64058137 AAGCCACCTGCCATGTTGTGAGG - Intergenic
955990630 3:64623315-64623337 AAGCCAGCTGCCATGTTGTGAGG + Intronic
956068743 3:65424931-65424953 CAGGCATGTGCCATCTTGTGAGG - Intronic
956341488 3:68229037-68229059 GAGCCAGATGCCATATTTGGAGG - Intronic
956358412 3:68419095-68419117 AAGCCAGCTACCACGTTGTGAGG - Intronic
956699240 3:71944242-71944264 AAGGCAGCTGCCATGTTGTGAGG - Intergenic
956700378 3:71953557-71953579 AAGCCAGCTGCCATGGTGTGAGG + Intergenic
956714645 3:72067929-72067951 AAGCCAGCTGCCATGTCATGAGG + Intergenic
956737212 3:72247072-72247094 CTGAGAGATGCCATGCTGTGTGG + Intergenic
956765375 3:72480359-72480381 AAGCCAGCTGCCATGTCATGAGG + Intergenic
956767293 3:72494397-72494419 AGGCCAGCTGCCATGTTGTGAGG - Intergenic
956776082 3:72566693-72566715 AAGTCAGCTGCCATGTTCTGAGG - Intergenic
956836208 3:73098197-73098219 ACCCCAGCTGCCATGTTGTGAGG + Intergenic
957275844 3:78090527-78090549 AATCCAGCTGCCATGCTGTGAGG - Intergenic
959302656 3:104622632-104622654 TAGTCAGATGCTGTGTTGTGTGG - Intergenic
959685954 3:109146657-109146679 AAGTCAGCTGCCATGTCGTGAGG - Intergenic
961238197 3:125386773-125386795 AAGCAAGCTCCCATGTTGTGAGG - Intergenic
961243149 3:125429798-125429820 AAGCCAGCCTCCATGTTGTGAGG + Intergenic
961486429 3:127220521-127220543 CAGCAAGAGGCCACGCTGTGTGG + Intergenic
961639891 3:128358510-128358532 CAGCCAGAGGCCATGCTGCCAGG - Intronic
962088707 3:132220238-132220260 AAGCTAGATGCCATGTCATGAGG + Intronic
962196870 3:133371489-133371511 GAGCCAGCTGCCATGCTGCGAGG - Intronic
962850607 3:139305961-139305983 AACCCAGATGCCATGCTGGGAGG + Intronic
963279600 3:143369851-143369873 AAGTCAGCTGCCCTGTTGTGAGG + Intronic
963738979 3:149055946-149055968 GAGCCAGCTGCCACGATGTGAGG + Intronic
963864224 3:150342930-150342952 AAGCCAGATGCTGTGTTGTGAGG - Intergenic
964328319 3:155572869-155572891 CAGCCAGGTGCAGTGGTGTGTGG - Intronic
964334753 3:155643284-155643306 TAGCCAGTCACCATGTTGTGTGG + Intronic
964667010 3:159185793-159185815 AAGCCAGATACCATGTTTTGAGG - Intronic
964689329 3:159432248-159432270 AAGGCAGCTGCCATGTTGTGAGG - Intronic
964695674 3:159505117-159505139 CAGCCAGATGAGATGTAGAGTGG + Intronic
965388439 3:168074058-168074080 AAGCCAGCTGCCATGTTATGAGG + Intronic
966631911 3:182085442-182085464 CACCCAGATAGCATGTTTTGGGG - Intergenic
966692067 3:182752167-182752189 AAGCTAGCTGCCATGTTATGAGG + Intergenic
967895481 3:194392697-194392719 AAGCCAGCTGCCATGTCATGAGG + Intergenic
968672768 4:1861005-1861027 CAGCCAGCTGCCAGGTCATGAGG + Intergenic
969967158 4:11008797-11008819 AAGCCCGCTGCCATGCTGTGAGG - Intergenic
970178326 4:13361938-13361960 AAGCCAGACACCATGCTGTGAGG - Intronic
971626405 4:28925620-28925642 CATCCAGATGCTATGCTGTGAGG - Intergenic
971642375 4:29151919-29151941 AAGCCAGCTGTCATGTTATGAGG - Intergenic
972085384 4:35208258-35208280 TAGTCAGATGCAATGCTGTGTGG - Intergenic
972682269 4:41317808-41317830 AAGCCAGCTGTCATGTTGTGAGG - Intergenic
972731636 4:41800749-41800771 AAGCCAGCTGCCATGTCATGAGG - Intergenic
972992176 4:44834197-44834219 AAGCCAGCTTCCATGCTGTGAGG - Intergenic
973829728 4:54746591-54746613 CACCCAGGTGGCCTGTTGTGTGG - Intergenic
974786531 4:66625207-66625229 CAGTCAGAAGCAATGCTGTGTGG - Intergenic
974868577 4:67610138-67610160 AACCTAGACGCCATGTTGTGAGG - Intergenic
975041542 4:69750577-69750599 GAGTCAGATGCAATTTTGTGTGG - Intronic
975089871 4:70389406-70389428 AATCAAGATGCCATGTTGTGGGG - Intronic
976864012 4:89702369-89702391 CACCCAGCCACCATGTTGTGAGG - Intergenic
977675163 4:99739500-99739522 AAGCCAGCTGCCATGTCATGAGG - Intergenic
977947808 4:102933697-102933719 AAGCCAGCTGCCATGTCCTGAGG - Intronic
979607051 4:122649666-122649688 AAGCCAGCCGCCATGTTGTGAGG - Intergenic
980017993 4:127675757-127675779 AAGCCAGTTGACATGTTATGAGG - Intronic
980162325 4:129180708-129180730 CAGCCATAAGCCATGCTGTCAGG + Intergenic
980636432 4:135510670-135510692 CACCCAGATTCCACGGTGTGGGG + Intergenic
983288922 4:165776053-165776075 AAGCCAGATGCCATGTTCTGAGG + Intergenic
985959171 5:3286762-3286784 AAGCAGCATGCCATGTTGTGAGG - Intergenic
986247410 5:6022820-6022842 AATCCAGCTGCCATGCTGTGAGG + Intergenic
986296633 5:6444727-6444749 CAGCCAGACACCATGTTGAGAGG - Intergenic
986667907 5:10119085-10119107 AACCCAGCAGCCATGTTGTGAGG - Intergenic
987111396 5:14690617-14690639 AAGCCAGCTGCCATGTTGTAAGG - Intronic
988663770 5:33302352-33302374 GAACCAGCTGCCATGCTGTGAGG - Intergenic
988724413 5:33911674-33911696 AAACCAGTTGCCATGCTGTGAGG + Intergenic
989002827 5:36778636-36778658 AAACCAGCTGCCATGTTGTTAGG - Intergenic
989185380 5:38620011-38620033 AAGCTAGATGCCATATTGTGAGG - Intergenic
990010048 5:50986785-50986807 ACCCCAGCTGCCATGTTGTGAGG + Intergenic
991005085 5:61821032-61821054 CAGCCAGCTGTGCTGTTGTGTGG - Intergenic
991240907 5:64458880-64458902 CAGCCAACTGCCAGGTTCTGGGG - Intergenic
991507199 5:67337654-67337676 CCTCTAGATGCCATGTTCTGAGG + Intergenic
993409938 5:87560867-87560889 CTTCCTGATGCTATGTTGTGAGG + Intergenic
994379969 5:99059025-99059047 AAGACAGCTGCCATGTTGTGAGG + Intergenic
996503208 5:124239716-124239738 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
998784650 5:145695736-145695758 AAGCCAGCTGCCATGTTGTGAGG - Intronic
999514123 5:152283907-152283929 AAGCCATTTGCCATGTTGTAAGG + Intergenic
999742740 5:154568877-154568899 CATCCAGATGCCAGGCTTTGAGG - Intergenic
1001405818 5:171476726-171476748 CAGACAGTGGCGATGTTGTGTGG + Intergenic
1001827640 5:174758748-174758770 CAGCCAGCTGCCATGTTGTGAGG + Intergenic
1003241002 6:4345787-4345809 TAGCAAGACGCCATGTTGGGAGG - Intergenic
1003332582 6:5142263-5142285 AACCCAGCCGCCATGTTGTGAGG + Intronic
1003593479 6:7455133-7455155 AAGTCAGCTGCCACGTTGTGAGG + Intergenic
1003676885 6:8212854-8212876 CATCAAGATGCCATATTGTTTGG - Intergenic
1003900210 6:10647926-10647948 CAGAGAGATGCGATGTTGTTGGG - Intergenic
1004195487 6:13500506-13500528 AAGCCAGCTGCCATGTCATGGGG + Intergenic
1004701653 6:18085277-18085299 AAGCTGGGTGCCATGTTGTGAGG + Intergenic
1004875053 6:19942922-19942944 AAGCCAGCTGCCATGTGGTGAGG + Intergenic
1004918342 6:20353300-20353322 AATCCAGCGGCCATGTTGTGAGG + Intergenic
1005420788 6:25647993-25648015 GTGCCAGATGCTATGTTCTGTGG + Intergenic
1005693393 6:28328983-28329005 AAGCCACCTGACATGTTGTGAGG + Intronic
1005765522 6:29007451-29007473 AAGCCAAATGCCATGTTGTAAGG + Intergenic
1007649058 6:43406148-43406170 AAGCCAGTTGCCATATTGTGAGG + Intergenic
1008823656 6:55664860-55664882 AGGCCAGCTGCCATGTAGTGAGG - Intergenic
1010032066 6:71281676-71281698 AAGCCAGTTGCCATGTCATGAGG - Intergenic
1010051641 6:71511460-71511482 AATCCAGCTGCCATATTGTGAGG + Intergenic
1010792578 6:80081527-80081549 AAGCCAGCTGCCAAATTGTGAGG + Intergenic
1012296667 6:97532888-97532910 GAGCCAGCTGCCATGTCATGAGG - Intergenic
1012399095 6:98830262-98830284 CAGCCAGCTGCCTTTTTGTGTGG + Intergenic
1012404983 6:98885901-98885923 AAGCCAGCTGCCATGTCATGAGG + Intronic
1012853578 6:104475171-104475193 AAGCCAGCTGCCATTTTGTGAGG - Intergenic
1017037851 6:150282883-150282905 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1017180956 6:151551577-151551599 AAGCCAGGGGCCATGGTGTGAGG + Intronic
1017296456 6:152801037-152801059 CAACCAGATGGAATGTTATGTGG + Intergenic
1017657232 6:156641686-156641708 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1018772617 6:166985195-166985217 AAGCCAGAGGTCATGTCGTGAGG - Intergenic
1019347228 7:537140-537162 ATGCCAGCCGCCATGTTGTGAGG - Intergenic
1019556646 7:1634795-1634817 AACCCAGCTGCCATGATGTGAGG - Intergenic
1019804595 7:3114024-3114046 AAGCCAGCCACCATGTTGTGAGG + Intergenic
1019826658 7:3290107-3290129 AGTCCAGCTGCCATGTTGTGGGG + Intergenic
1020672645 7:11137211-11137233 CAGCCATTTGTCATGTTCTGTGG - Intronic
1021075745 7:16302363-16302385 CAGACACATGCCATGTTGGCAGG - Intronic
1021419290 7:20426712-20426734 AAGCCAGCTGCCATGTTTTGAGG + Intergenic
1021912969 7:25404938-25404960 CAGCGAGCTTGCATGTTGTGAGG - Intergenic
1022167648 7:27785767-27785789 AAGCTAGCTGCCATGCTGTGAGG - Intronic
1022359811 7:29647074-29647096 AAGCCAGCTGTCATGTTGTGAGG + Intergenic
1022368615 7:29749731-29749753 AAGCCAGTTGTCATGTTGTGAGG + Intergenic
1022898695 7:34780058-34780080 AAGCCAGCTACTATGTTGTGAGG - Intronic
1022990392 7:35701542-35701564 AATCCAGCTGCCATGTTTTGAGG - Intergenic
1023213497 7:37833384-37833406 CAGCCAGAAAGCATGTTATGGGG - Intronic
1023730503 7:43187180-43187202 GAGGCATCTGCCATGTTGTGAGG - Intronic
1024103987 7:46062494-46062516 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG + Intronic
1024321181 7:48071509-48071531 CAGCCAACTGCCATGGGGTGAGG + Intergenic
1026180022 7:68030740-68030762 AAACCAGTCGCCATGTTGTGGGG - Intergenic
1026490801 7:70861698-70861720 CACCCAGCTGCCATGATGTGAGG + Intergenic
1026490974 7:70863110-70863132 CACCCAGCTGCCATGATGTGAGG - Intergenic
1026980214 7:74522052-74522074 AAACCAGTGGCCATGTTGTGAGG - Intronic
1028128570 7:87143860-87143882 AAGCCAGCTGCCATGTTGAGAGG + Intergenic
1028701373 7:93784699-93784721 GAGCCAGTTGCCACGTTCTGAGG - Intronic
1029243315 7:99180111-99180133 AAGCCAGCTGCCGTGATGTGAGG + Intronic
1029985765 7:104921913-104921935 ATCCCAGCTGCCATGTTGTGAGG - Intergenic
1029985919 7:104923231-104923253 AAGCCAGTCGCCATGTTGTGAGG + Intergenic
1030120212 7:106102455-106102477 AAGCCAGTGGCCATGTTGGGAGG + Intronic
1034126041 7:148672338-148672360 AAGTTAGCTGCCATGTTGTGAGG - Intergenic
1034309402 7:150073209-150073231 CAGCGAGAAGCCATCTTCTGTGG + Intergenic
1034865208 7:154635837-154635859 AAGCTGGCTGCCATGTTGTGAGG - Intronic
1036660974 8:10708406-10708428 AACCCAACTGCCATGTTGTGAGG - Intronic
1037733003 8:21544983-21545005 CAGCCAGTTGCTATGTGTTGTGG + Intergenic
1038282397 8:26177883-26177905 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1039596725 8:38797128-38797150 CAGCCAGCTGCCATGCTGTGAGG - Intronic
1039792091 8:40884195-40884217 TAGCCAGAGGCCATGTGATGGGG - Intronic
1040896338 8:52373005-52373027 CAGCAGAATGCCATGTTTTGGGG + Intronic
1041911703 8:63095842-63095864 CAGCTAGATGCCAAGTAGTTTGG + Intergenic
1042423615 8:68620562-68620584 CAGCCAGATGCCACCTAGAGTGG + Intronic
1043916968 8:85934129-85934151 AAGCTAGCTGCCACGTTGTGAGG - Intergenic
1044485421 8:92747538-92747560 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1045320165 8:101076447-101076469 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1045487313 8:102641739-102641761 AAGCCAGTTGTCATGTTGTGAGG - Intergenic
1047697092 8:127414905-127414927 AATCCAGCTGACATGTTGTGAGG + Exonic
1047891274 8:129313809-129313831 AAGCCAGCTGTCATGATGTGAGG + Intergenic
1048350517 8:133612108-133612130 CAGTCAGATCACATTTTGTGTGG - Intergenic
1048412746 8:134192339-134192361 ATGCCAGCTGCCATGTTGTGAGG + Intergenic
1048495200 8:134929471-134929493 AAGCCAGCTGCCATGTTGAAAGG + Intergenic
1048571727 8:135662457-135662479 AAGCCAGATGTCATGTTGTGAGG - Intergenic
1049252072 8:141594587-141594609 GACCCAGCTGCCATGTTGTAAGG + Intergenic
1049278394 8:141731527-141731549 CAGCCAGGGGCCATGGGGTGTGG - Intergenic
1049283868 8:141764107-141764129 AAACCAGTTGCCATATTGTGCGG - Intergenic
1049360208 8:142209207-142209229 GAGCCAGCTGCCATCTTGTAAGG + Intergenic
1049546775 8:143235739-143235761 AAGCCGGCCGCCATGTTGTGAGG - Intergenic
1050499210 9:6277287-6277309 CGGCCTGATGCCATGCAGTGTGG + Intergenic
1051262861 9:15281817-15281839 CAGGCACATGCCATGTAGTCCGG + Intronic
1052246490 9:26341880-26341902 AAGCCAATTGCCATGTAGTGAGG - Intergenic
1055213020 9:73821590-73821612 GATCCAGCTGTCATGTTGTGAGG - Intergenic
1055931501 9:81564235-81564257 AAGCCAGTTGCCATTTTGTGAGG - Intergenic
1056302847 9:85259508-85259530 CAGCCGTATGCCAAGTTCTGTGG - Intergenic
1056514448 9:87336634-87336656 CAGCCAGATGCCATCTAGCGGGG + Intergenic
1056897614 9:90565557-90565579 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1056947569 9:91012977-91012999 AATCCAGCTGCCATATTGTGAGG + Intergenic
1057054863 9:91952448-91952470 AAGCTAGAAGCCATCTTGTGAGG - Intergenic
1057190719 9:93085859-93085881 ACGCCGGCTGCCATGTTGTGAGG - Intergenic
1057884401 9:98819064-98819086 AAGCCGGCTGCCATGTTGTGAGG - Intronic
1058439950 9:104997527-104997549 CAGCCAAAAGCCATCTTTTGGGG - Intergenic
1059524651 9:114979444-114979466 CAGACAAATGCCCTGTTATGTGG - Intergenic
1060495922 9:124118558-124118580 CAGCCAGGTTCCTTGTTGTCTGG + Intergenic
1061233880 9:129331039-129331061 AAGCCAGCCGCCATATTGTGGGG - Intergenic
1061646785 9:132009495-132009517 GAGCCAGAAGCCATGTCATGAGG + Intronic
1061965094 9:134009022-134009044 AACACAGACGCCATGTTGTGCGG - Intergenic
1185641740 X:1592326-1592348 CAGCCTGAGGCCATGCTGGGGGG + Intronic
1186516213 X:10167618-10167640 AAGCCAACTGCCATGTCGTGGGG + Intronic
1186922296 X:14295424-14295446 AAGCCAACTGCCATGTTGTAAGG + Intergenic
1186957679 X:14701052-14701074 CAATCAGATGCCATCATGTGGGG - Intronic
1187200294 X:17127987-17128009 CAGTCAGCTGCCACATTGTGAGG - Intronic
1187217420 X:17290557-17290579 AAGCCAGCTGCCATATTGTGAGG - Intergenic
1187893530 X:23959969-23959991 AAGCTAGCTGCCATGTAGTGAGG - Intergenic
1188803223 X:34557116-34557138 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1189179985 X:38994661-38994683 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1189288421 X:39868200-39868222 CAGCAGGATGCCATGGTGAGGGG - Intergenic
1189300834 X:39951214-39951236 AAGCCAGCGGCCATGTGGTGAGG - Intergenic
1189342476 X:40214970-40214992 AAGCCAGCTGCCATGTTGTTAGG + Intergenic
1189352861 X:40289980-40290002 AAGCCAGCTGCCATATTGTGAGG - Intergenic
1189368662 X:40410381-40410403 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1189371000 X:40429208-40429230 AAGCCAGTTGCCATATTGTGAGG + Intergenic
1189477875 X:41370486-41370508 CAGGCATATGCCATGGTGTCTGG + Intergenic
1190489112 X:50963377-50963399 AAGCAAGTTTCCATGTTGTGAGG - Intergenic
1191141154 X:57118153-57118175 CAGCCTCAGGCCATGTTGGGTGG + Intergenic
1191142757 X:57133876-57133898 CAGCCTCAGGCCATGTTGGGTGG + Intergenic
1193892452 X:87066826-87066848 AAGTCAGATGCCATGTTCTAAGG - Intergenic
1194579330 X:95652523-95652545 AAGTAAGTTGCCATGTTGTGAGG + Intergenic
1196487932 X:116235413-116235435 CAGCCATATGATAGGTTGTGTGG + Intergenic
1196802304 X:119554673-119554695 AAGCCAGCTGCCATGTCATGAGG + Intronic
1197002452 X:121454082-121454104 CAGTCAGAGGCAATGCTGTGTGG - Intergenic
1198422996 X:136486560-136486582 CAGCTAGAAACCATGTAGTGAGG - Intergenic
1198620477 X:138503140-138503162 AAGCCAAATGCCATGTCGTCAGG + Intergenic
1198756366 X:139986675-139986697 TAGTCAGATGCTATGTCGTGTGG - Intergenic
1199012948 X:142778510-142778532 TAGTCAGATGCCATGCTGTATGG - Intergenic
1199471256 X:148198659-148198681 AAGCCAAATTCCTTGTTGTGGGG + Intergenic
1201183225 Y:11370424-11370446 AAGCCAGCTGCCATGTTCTGAGG - Intergenic
1201390315 Y:13490330-13490352 CAGCAAGGTGCCATATTGAGAGG - Intergenic
1201569088 Y:15395228-15395250 AAGACAGAGGCCATGGTGTGCGG + Intergenic
1202371184 Y:24197116-24197138 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1202376157 Y:24239425-24239447 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1202494623 Y:25430693-25430715 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1202499600 Y:25473001-25473023 AAGCCAGTTGCCATGTGATGAGG - Intergenic