ID: 1024251899

View in Genome Browser
Species Human (GRCh38)
Location 7:47511930-47511952
Sequence GCACCGTGGCAGCCAATAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251899_1024251906 29 Left 1024251899 7:47511930-47511952 CCCGTTATTGGCTGCCACGGTGC No data
Right 1024251906 7:47511982-47512004 CCTTGTTCCACCTGTTCCCATGG No data
1024251899_1024251907 30 Left 1024251899 7:47511930-47511952 CCCGTTATTGGCTGCCACGGTGC No data
Right 1024251907 7:47511983-47512005 CTTGTTCCACCTGTTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251899 Original CRISPR GCACCGTGGCAGCCAATAAC GGG (reversed) Intronic