ID: 1024251899 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:47511930-47511952 |
| Sequence | GCACCGTGGCAGCCAATAAC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1024251899_1024251907 | 30 | Left | 1024251899 | 7:47511930-47511952 | CCCGTTATTGGCTGCCACGGTGC | No data | ||
| Right | 1024251907 | 7:47511983-47512005 | CTTGTTCCACCTGTTCCCATGGG | No data | ||||
| 1024251899_1024251906 | 29 | Left | 1024251899 | 7:47511930-47511952 | CCCGTTATTGGCTGCCACGGTGC | No data | ||
| Right | 1024251906 | 7:47511982-47512004 | CCTTGTTCCACCTGTTCCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1024251899 | Original CRISPR | GCACCGTGGCAGCCAATAAC GGG (reversed) | Intronic | ||