ID: 1024251900

View in Genome Browser
Species Human (GRCh38)
Location 7:47511931-47511953
Sequence GGCACCGTGGCAGCCAATAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251900_1024251907 29 Left 1024251900 7:47511931-47511953 CCGTTATTGGCTGCCACGGTGCC No data
Right 1024251907 7:47511983-47512005 CTTGTTCCACCTGTTCCCATGGG No data
1024251900_1024251908 30 Left 1024251900 7:47511931-47511953 CCGTTATTGGCTGCCACGGTGCC No data
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251900_1024251906 28 Left 1024251900 7:47511931-47511953 CCGTTATTGGCTGCCACGGTGCC No data
Right 1024251906 7:47511982-47512004 CCTTGTTCCACCTGTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251900 Original CRISPR GGCACCGTGGCAGCCAATAA CGG (reversed) Intronic