ID: 1024251902

View in Genome Browser
Species Human (GRCh38)
Location 7:47511952-47511974
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024251902_1024251908 9 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251908 7:47511984-47512006 TTGTTCCACCTGTTCCCATGGGG No data
1024251902_1024251907 8 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251907 7:47511983-47512005 CTTGTTCCACCTGTTCCCATGGG No data
1024251902_1024251911 16 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251911 7:47511991-47512013 ACCTGTTCCCATGGGGACCAGGG No data
1024251902_1024251906 7 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251906 7:47511982-47512004 CCTTGTTCCACCTGTTCCCATGG No data
1024251902_1024251910 15 Left 1024251902 7:47511952-47511974 CCTTCCACGAAGCTCCATGTACT 0: 1
1: 0
2: 2
3: 25
4: 181
Right 1024251910 7:47511990-47512012 CACCTGTTCCCATGGGGACCAGG 0: 1
1: 0
2: 1
3: 22
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024251902 Original CRISPR AGTACATGGAGCTTCGTGGA AGG (reversed) Intronic